Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

약배양 이용 벼멸구, 흰잎마름병 및 줄무늬잎마름병 저항성 복합 내병충성 벼 계통 육성

Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice

The Korean Journal of Breeding Science 2014;46(1):78-89.
Published online: February 28, 2014

1농촌진흥청 국립식량과학원 벼맥류부

1Department of Rice and Winter Cereal Crop, NICS, RDA, Iksan 570-080, Korea

2농촌진흥청 국립식량과학원

2National Institute of Crop Science, RDA, Suweon 441-857, Korea

3농촌진흥청 연구정책국

3Research Policy Bureau, RDA, Suweon 441-707, Korea

*Corresponding author (E-mail: mayoe@korea.kr, Tel: +82-63-840-2256, Fax: +82-63-840-2119)
• Received: February 3, 2014   • Revised: February 27, 2014   • Accepted: March 3, 2014

© The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 119 Views
  • 0 Download
  • 6 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Association Analysis of Yield-Related Traits in Rice Following the Introduction of Brown Planthopper Resistant Genes
    Jae-Ryoung Park, Jeonghwan Seo, Chang-Min Lee, Songhee Park, Mina Jin, Keon Mi Lee, O-Young Jeong, Jung-Pil Suh, Hyun-Su Park
    Korean Journal of Breeding Science.2024; 56(4): 381.     CrossRef
  • Breeding of “Drimi3ho” a High-Quality, Multi-Resistant Rice Cultivar having Excellent Field Agronomic Traits
    Yoon-Hee Jang, Jae-Ryoung Park, Eun-Gyeong Kim, Jae-Keun Sohn, Gang-Seob Lee, Kyung-Min Kim
    Korean Journal of Breeding Science.2022; 54(4): 385.     CrossRef
  • Biotechnological Approaches for Host Plant Resistance to Insect Pests
    Pritam Kumari, Poonam Jasrotia, Deepak Kumar, Prem Lal Kashyap, Satish Kumar, Chandra Nath Mishra, Sudheer Kumar, Gyanendra Pratap Singh
    Frontiers in Genetics.2022;[Epub]     CrossRef
  • Breeding of ‘Drimi 1ho’, aJaponicaRice Cultivar Resistant to Brown Planthoppers
    Yoon-Hee Jang, Jae-Ryoung Park, Eun-Gyeong Kim, Jae-Keun Sohn, Gang-Seob Lee, Kyung-Min Kim
    Korean Journal of Breeding Science.2022; 54(3): 215.     CrossRef
  • Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross
    Chang-Min Lee, Hyun-Su Park, Man-Kee Baek, Jung-Pil Suh, O-Young Jeong, Song-Joong Yun, Suk-Man Kim
    Korean Journal of Breeding Science.2021; 53(4): 392.     CrossRef
  • Multiple Disease Resistant Early Maturing Rice Cultivar ‘IS592BB’ with the Genetic Background of ‘Unkwang’
    Hyun-Su Park, Man-Kee Baek, Woo-Jae Kim, Chang-Min Lee, Hyeonso Ji, Jung-Pil Suh, O-Young Jeong, Young-Chan Cho, Jeom-Ho Lee
    Korean Journal of Breeding Science.2020; 52(4): 473.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice
Korean. J. Breed. Sci.. 2014;46(1):78-89.   Published online March 31, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice
Korean. J. Breed. Sci.. 2014;46(1):78-89.   Published online March 31, 2014
Close

Figure

  • 0
  • 1
  • 2
  • 3
Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice
Image Image Image Image
Fig. 1. PCR analysis to confirm the resistance genes using the gene specific DNA markers. Stvb-i, Bph18, Xa3, Xa4, and xa5 was confirmed by PCR product amplified with primer, ST10 (A), 7312.T4A(cleaved by HinfI, B), 9643.T4 (cleaved by TaqαI, C), 10571.T14 (cleaved by Tsp509 I, D), and 10603.T10Dw (cleaved by Rsa I, E), respectively. The white stars represent the lines carrying the resistance genes.
Fig. 2. Resistance reaction of SR30071-3-7-23-6-2-1-1 (A) and double haploid lines (B) derived from the combination of HR26234-15-1-1/SR30071-3-7-23-6-2-1-1 to brown planthopper at seedling stage.
Fig. 3. Resistance reaction to brown planthopper. At seedling stage (A). At maximum tillering stage (B). 1: Nampyeongbyeo, 2: Jinbaek, 3: Anmi, 4: HR28869-AC65, 5: HR28869-AC68, 6: HR28869-AC75, 7: HR28869-AC117, 8: HR28869-AC157, 9: HR28869-AC158, 10: HR28869-AC159. Check variety is Nampyeongbyeo.
Fig. 4. Resistance reaction to bacterial blight, K3a (HB1009 isolate) race. Lesion length at 2 weeks after inoculation (A). Field scenery at maturing stage after inoculation (B). 1: Nampyeongbyeo, 2: Jinbaek, 3: Anmi, 4: HR28869-AC65, 5: HR28869-AC68, 6: HR28869-AC75, 7: HR28869-AC117, 8: HR28869-AC157, 9: HR28869-AC158, 10: HR28869-AC159. White bar indicates 10 cm.
Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice

Gene-specific PCR primers used for the identification of resistance genes

R-genes Chr. No. Marker name Primer sequences
Expected size Reference
Forward (5’-3’), Reverse (5’-3’) (bp)

Stvb-i 11 ST10 CGAAAGATGGTTTCTCCACC 727 Hayano-Saito et. al. (2000)
GACCAAGCAACTAATGACGC
Bph18 12 7312.T4A ACGGCGGTGAGCATTGG 398 Jena et al. (2006)
TACAGCGAAAAGCATAAAGAGTC 566
Xa3 11 9643.T4 AGCCGAGCAATGATACCGACA 290 Jeung et al. (unpublished)
ACAACTGGGATCGAACCGACA
Xa4 11 10571.T14 TGTTGGAGGATTGGCAAGGAA 570 Jeung et al. (unpublished)
TTCGTTGCGGCGTTGTTAATC
xa5 5 10603.T.10Dw GCACTGCAACCATCAATGAATC 280 Jeung et al. (unpublished)
CCTAGGAGAAACTAGCCGTCCA

Characteristics of the parents using anther culture

Parents Heading date (DASz) Culm length (cm) Panicle length (cm) No. of panicles per hill Reaction to
Resistance genes
rice stripe virus brown plant-hopper bacterial blight
K1 race K3a race

HR26234-15-1-1 104 72 18 13 Ry S R R Xa3+xa5+Stvb-i
SR30071-3-7-23-6-2-1-1 99 83 22 9 R R R R Xa4+Bph18+Stvb-i

Day after seedling

R and S mean resistant and susceptible to insect and disease.

Anther culture ability and double haploid lines derived from the cross of HR26234-15-1-1/SR30071-3-7-23-6-2-1-1

Anther cultured Cali induced Plant regeneration Green plants Albino Double haploid lines
(no.) (no. and %) (no. and %)z (no. and %)y (no. and %)x (no.)w

5,300 1,898 (35.8) 399 (21.0) 232 (58.1) 167 (41.9) 213

Percent plant regeneration is the number of plants regenerated over number of cali plated

Percent green is the number of green plants regenerated over total plants regenerated

Percent albino is the number of albino plants regenerated over total plants regenerated

Double haploid lines are harvested plants having fertile grain.

Agronomic characteristics of the groups classified by resistance genes combination and their resistance reaction to brown planthopper and bacterial blight

Resistance gene
No. of lines Reaction to BPH Reaction to BB
Heading date (DAS) Culm length (cm) Panicle length (cm) No. of panicles per hill Remark
RSVz BPH BB K1 K3a

Stvb-i Bph18 Xa3 10 R R S 112 ± 2.4aby 77.1 ± 3.5bc 19.3 ± 1.7c 9.7 ± 1.3c sterility
Xa4 9 R R 106 ± 1.9abc 80.4 ± 5.0ab 22.0 ± 0.7a 12.1 ± 1.0a
Xa3+xa5 13 R R 113 ± 13.0a 83.7 ± 10.8a 20.6 ± 1.2b 11.9 ± 1.9a sterility
Xa4+xa5 10 R R 101 ± 1.8c 76.8 ± 4.2bc 21.0 ± 0.8b 11.9 ± 1.4a

Total 42 108 ± 8.9A 79.8 ± 7.4A 20.7 ± 1.5A 11.4 ± 1.7A

bph18 Xa3 53 S R S 107 ± 12.5abc 68.4 ± 6.9d 20.4 ± 1.1b 11.8 ± 1.6ab
Xa4 60 R R 104 ± 8.0bc 70.1 ± 7.9d 20.7 ± 1.1b 11.4 ± 1.5ab
Xa3+xa5 51 R R 109 ± 10.abc 70.4 ± 6.2d 20.8 ± 1.4b 11.7 ± 1.6ab
Xa4+xa5 7 R R 103 ± 7.1c 71.8 ± 4.6cd 20.9 ± 0.9b 10.5 ± 1.5bc

Total 171 106 ± 10.3A 69.7 ± 7.0B 20.7 ± 1.2A 11.6 ± 1.6A

RSV: rice stripe virus, BPH: brown planthopper, BB: bacterial blight

Means with same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

Yield-related traits of varieties and DH lines at yield trial

Var./lines Heading date Culm length Panicle length No. of panicles per hill No. of spikelets per panicle Ratio of ripened grain 1,000 grain weight of brown rice Rough rice yield Brown/rough rice ratio Brown rice yield Index of brown rice yieldy
(DASz) (cm) (cm) (%) (g) (kg/10a) (%) (kg/10a) (%)

Nampyeongbyeo 106bx 78.3a 20.0bc 14 95b 90.1a 20.9ab 647a 79.2 512a 100
Jinbaek 110a 71.4b 20.8b 15 93b 87.6a 21.3a 643a 79.8 513a 100
Anmi 102c 76.5a 22.9a 13 119a 84.0ab 20.3b 674a 79.4 535a 104
HR28869-AC65 96d 65.6d 19.8c 13 102ab 77.8bcd 20.6ab 528b 79.2 419bc 82
HR28869-AC68 96d 67.4bcd 19.9c 13 114a 78.5bcd 20.3b 517b 79.2 410bc 80
HR28869-AC75 96d 67.5bcd 20.3bc 12 118a 80.7bc 21.2a 508b 79.6 404bc 79
HR28869-AC117 97d 70.6bc 20.1bc 12 107ab 78.7bc 20.9ab 527b 79.6 419bc 82
HR28869-AC157 96d 67.0cd 20.0bc 12 114a 74.8cd 21.1a 505b 79.2 400c 78
HR28869-AC158 96d 67.1bcd 20.3bc 12 109ab 79.4bc 21.2a 537b 79.6 428b 84
HR28869-AC159 96d 68.5bcd 20.4bc 12 107ab 72.0d 20.9ab 508b 79.7 405bc 79

Day after seedling

Brwon rice yield of Nampyeongbyeo was a standard

xMeans with the same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

Reaction of varieties and DH lines to brown planthopper, bacterial blight, and rice stripe virus

Var./lines Brown planthopper
Bacterial blight
Rice stripe virus Resistance genes
at seedling at maximum tillering K1 K2 K3 K3a

Nampyeongbyeo Sz S S S S S R Stvb-i
Jinbaek S S R R R R S Xa3+xa5
Anmi R R R R R S R Bph18+Xa3+Stvb-i
HR28869-AC65 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC68 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC75 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC117 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC157 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC158 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC159 R R R R R R R Bph18+Xa4+xa5+Stvb-i

R and S mean resistant and susceptible to insect and disease.

Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice

Var./lines Control
K3a inoculation
Rough rice yield Brown rice yield Ratio of ripened grain Perfect kernel of brown rice Rough rice yield Brown rice yield Ratio of ripened grain Perfect kernel of brown rice
(g) (g) (%) (%) (g) (g) (%) (%)

Nampyeongbyeo 549 447 87.8 74.5 470**z 378** 79.5** 63.9**
Jinbaek 543 447 85.3 84.2 539ns 443ns 85.0ns 82.2ns
Anmi 554 455 83.7 76.1 490** 399** 71.5** 72.1*
HR28869-AC65 376 304 83.7 72.1 362ns 292ns 81.7ns 70.1ns
HR28869-AC68 445 362 78.1 75.3 417ns 341ns 77.7ns 74.4ns
HR28869-AC75 406 331 73.2 73.7 389ns 318ns 65.6ns 72.4ns
HR28869-AC117 431 352 76.6 73.7 394* 322* 74.6ns 73.6ns
HR28869-AC157 429 352 75.9 73.8 419ns 343ns 70.8ns 72.7ns
HR28869-AC158 450 368 75.7 72.2 419ns 343* 70.2ns 70.9ns
HR28869-AC159 430 352 72.3 73.1 407ns 332* 71.7ns 71.8ns

ns, *, and **mean no significant, significant at P< 0.05, and P< 0.01 by t-test, respectively.

Table 1 Gene-specific PCR primers used for the identification of resistance genes
Table 2 Characteristics of the parents using anther culture

Day after seedling

R and S mean resistant and susceptible to insect and disease.

Table 3 Anther culture ability and double haploid lines derived from the cross of HR26234-15-1-1/SR30071-3-7-23-6-2-1-1

Percent plant regeneration is the number of plants regenerated over number of cali plated

Percent green is the number of green plants regenerated over total plants regenerated

Percent albino is the number of albino plants regenerated over total plants regenerated

Double haploid lines are harvested plants having fertile grain.

Table 4 Agronomic characteristics of the groups classified by resistance genes combination and their resistance reaction to brown planthopper and bacterial blight

RSV: rice stripe virus, BPH: brown planthopper, BB: bacterial blight

Means with same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

Table 5 Yield-related traits of varieties and DH lines at yield trial

Day after seedling

Brwon rice yield of Nampyeongbyeo was a standard

xMeans with the same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

Table 6 Reaction of varieties and DH lines to brown planthopper, bacterial blight, and rice stripe virus

R and S mean resistant and susceptible to insect and disease.

Table 7 Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice

ns, *, and **mean no significant, significant at P< 0.05, and P< 0.01 by t-test, respectively.