Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

약배양 이용 벼멸구, 흰잎마름병 및 줄무늬잎마름병 저항성 복합 내병충성 벼 계통 육성

Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice

The Korean Journal of Breeding Science 2014;46(1):78-89.
Published online: February 28, 2014

1농촌진흥청 국립식량과학원 벼맥류부

1Department of Rice and Winter Cereal Crop, NICS, RDA, Iksan 570-080, Korea

2농촌진흥청 국립식량과학원

2National Institute of Crop Science, RDA, Suweon 441-857, Korea

3농촌진흥청 연구정책국

3Research Policy Bureau, RDA, Suweon 441-707, Korea

*Corresponding author (E-mail: mayoe@korea.kr, Tel: +82-63-840-2256, Fax: +82-63-840-2119)
• Received: February 3, 2014   • Revised: February 27, 2014   • Accepted: March 3, 2014

© The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 117 Views
  • 0 Download
  • 6 Crossref
prev next
  • This study was conducted to develop multi-resistant lines to brown planthopper, bacterial blight, and rice stripe virus using anther culture in rice. A total of 213 double haploid lines were developed the cross between HR26234-12-1-1 conferring resistant to bacterial blight and rice stripe virus and SR30071-3-7-23-6-2-1-1 conferring resistant to brown planthopper, bacterial bight, and rice stripe virus. Using DNA molecular marker, HR26234 and SR30071 were confirmed to have Xa3+xa5+Stvb-i and Bph18+Xa4+Stvb-i, respectively. All double haploid lines carried Stvb-i, and Bph18+Xa3, Bph18+Xa4, Bph18+Xa3+xa5, Bph18+Xa4+xa5, bph18+Xa3, bph18+Xa4, bph18+Xa3+xa5, and bph18+Xa4+xa5 combinations were identified. Segregation distortions such as no combinations carrying Bph18(or bph18)+xa5+Stvb-i and fewer lines carrying Bph18 than bph18 were occurred in DH population. Brown planthopper resistant lines carrying Bph18 showed longer culm length than susceptible lines. Selected Bph18+Xa4+xa5+Stvb-i combination lines with short culm conferred resistant to brown planthopper, bacterial blight, and rice stripe virus, while showed deleterious effects such as spikelet sterility, lower yield, and vulnerable to lodging than standard and comparative varieties. Using anther culture, we rapidly developed multi-resistant lines to brown planthopper, bacterial blight, and rice stripe virus. However, distorted segregation in DH population and linkage drag with Bph18 were obstacles to develop practical multi-resistant cultivars.
지속 가능하고 안정적인 쌀 생산을 위해서는 병해충에 대 한 관리가 필수적이다(Savary et al. 2006). 벼의 병해충에 의 한 피해를 가장 적극적으로 대처하는 방법은 저항성 품종을 개발하고 이를 재배하는 것이다(Khush 1989). 세계 각국에서 벼 병해충에 대한 저항성 품종 육종사업이 수행되고 있다. 우 리나라 자포니카 벼 품종에 대해 가장 피해를 많이 주는 병은 도열병, 벼흰잎마름병, 벼줄무늬잎마름병이며, 해충은 벼멸구 에 의한 피해가 가장 많다(Lee et al. 2011). 저항성 육종사업 은 해당 병해충에 대해 효과적인 저항성원을 확보하고 이를 우량 품종으로 도입하는 일련의 과정을 거친다.
자포니카 유전자원은 협소한 유전적 배경으로 생물적 스트 레스에 저항성인 유전자를 확보하는데 제한적이다(Jeung et al. 2005). 자포니카는 인디카에 비해 상대적으로 약한 벼멸 구 저항성을 나타내며, 벼멸구 저항성 주동 유전자 중 대부분 인 26개가 인디카와 야생벼로부터 발견되었다(Huang et al. 2013). Bph18 저항성 유전자는 야생벼 O.australiensis로부터 인디카 계통에 이전되었고 마커 활용 선발법(marker-assisted selection; MAS)과 전 게놈의 배경 분석(genome-wide background analysis)을 통해 자포니카 주남벼 배경에 도입되었다(Jena et al. 2006, Suh et al. 2011). Bph18 도입 계통들은 벼멸구 유 묘 및 성체검정에서 강한 저항성 반응을 나타냈으며, 선발된 우량 계통이 2010년에 품종명 안미로 등록되었다. 벼흰잎마 름병 저항성 유전자 Xa2 (Tetep), Xa4 (TKM6), Xa11 (IR8), Xa18 (IR24) 등은 인디카 품종에서 유래하였고, 야생벼로부 터 Xa21 (O. longistaminata), Xa23 (O. rufipogon), Xa27(t)Xa35(t) (O. minuta), Xa38 (O. nivara)이 도입되었다. 우 리나라 벼흰잎마름병 저항성원으로 많이 활용되고 있는 Xa3 는 저항성이 자포니카 일본 품종인 Wase Aikoku 3로부터 유 래하였고 1991년에 저항성 품종인 화영벼와 안중벼가 개발된 이후로 이를 이용하여 많은 우량 품종이 개발되었다(Kim et al. 2007, Shin et al. 2011). 여교배를 통해 방글라데시 Aus 품종 DV85의 xa5를 자포니카 수원345호 배경으로 도입한 근동질 유전자 계통이 육성되었고 실질적인 품종 개발로 이 어져 2006년에 강백이 육성되었고, 이를 활용하여 Xa3xa5 가 결합된 진백(2008)이 개발되어 변이균인 K3a에 대응할 방 안을 마련하였다(Shin et al. 2011). 우리나라 자포니카 벼 품 종의 벼줄무늬잎마름병 저항성은 인디카 Modan 유래 저항성 유전자 Stvb-i가 도입되어 안정적으로 이용되고 있다(Kwon et al. 2012). 1975년에 최초의 저항성 품종인 낙동벼가 개발 (Chung et al. 1975)된 이후로 저항성 품종개발에 Stvb-i이 지속적으로 이용되고 있다.
여러 육종 방법 중에서 약배양은 육종기간을 단축시키고 분리집단에서 고정계통을 개발하는데 유용하다(Grewal et al. 2011). 농촌진흥청에서는 약배양을 통해 1985년에 화성벼가 개발된 이후로 2013년까지 27개 품종이 개발되었다. 병해충 저항성 육종사업에서 표현형 정보만을 이용할 경우 생물검정 의 어려움과 하나의 저항성 유전자가 다른 저항성 유전자의 효과를 숨길 수 있기 때문에 여러 개의 저항성 유전자를 집적 시키거나 다양한 병해충에 대한 저항성 품종 개발에 어려움 이 따른다(Lee et al. 2011, Yoshimura et al. 1995). 해당 저 항성 유전자를 표지하는 분자 마커가 개발되어 있을 경우 이 를 활용하여 저항성유전자 도입 여부를 초기 세대부터 확인 할 수 있으며 여러 저항성 유전자를 하나의 품종에 집적시킬 수 있다(Dokku et al. 2013, Suh et al. 2013, Xu 2013).
본 연구는 벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에 저항 성인 자포니카 복합내병충성 품종을 조기에 개발하고자 약배 양을 수행하여 고정계통을 육성하고, DNA 분자 마커를 활용 하여 저항성 유전자를 확인함과 동시에 병해충에 대한 생물 검 정을 통해 목표 저항성 유전자가 집적된 복합 내병충성 계통을 선발하고자 수행되었다. 또한 육성 과정 중에 발생할 수 있는 문제점을 파악하여 저항성 육종사업에 반영하고자 하였다.
시험재료 및 재배방법
벼흰잎마름병과 벼줄무늬잎마름병에 저항성인 계통 HR26234-15-1-1을 자방친으로 하고 벼멸구, 벼흰잎마름병 및 벼줄무늬 잎마름병에 저항성인 계통 SR30071-3-7-23-6-2-1-1을 화분 친으로 하여 인공 교배한 F1을 약배양하여 얻은 double haploid (DH) 213계통을 이용하였다. 이들 계통을 2011년 국립식량과학원 벼맥류부 시험포장에 재식거리 30 × 15 cm 로 주당 1본씩 이앙하였다. 주요 농업 형질 조사와 벼흰잎마 름병 균계 검정을 수행하였고 벼멸구 저항성 검정은 유묘 검 정법을 이용하였다. DNA 분자 표지를 이용하여 이들 계통에 대한 저항성 유전자를 확인하였다. 2011년에 선발된 저항성 유전자가 집적된 7개 계통을 표준품종 남평벼, 비교품종 진 백, 안미와 함께 2012년에 재식거리 30 × 15 cm로 주당 3본 식, 구당 180 주 가량을 3반복으로 이앙하여 생산력 검정시험 을 수행하였다. 벼흰잎마름병 접종에 따른 수량성 및 품질 변 이를 조사하기 위해서 생산력 검정시험에 공시된 동일한 재 료를 재식거리 30 × 15 cm로 주당 3본식, 구당 180 주 가량 을 무접종구, 접종구로 나누어 이앙하였다. 접종 시험구는 대 조 품종의 최고 분얼기에 K3a 균계(HB0109 균주)를 이용하 여 시험구 전개체를 가위 절엽접종하였다. 시비량은 N-P2O5-K2O를 90-45-57 kg/ha으로 질소는 기비 : 분얼비 : 수비를 50 : 20 : 30 비율로 분시하였고, 인산은 전량 기비로, 칼륨은 기비 : 수비를 70 : 30 비율로 분시하였다. 그 밖의 재배 방법 은 농촌진흥청 표준 재배법을 따랐다.
병해충 저항성 검정
벼멸구 저항성 검정에 이용된 벼멸구는 국립식량과학원 벼 맥류부 간척지농업과 해충 사육실에서 동진벼를 식이품종으 로 사육된 벼멸구를 이용하였다. 벼멸구 유묘 검정은 60 × 30 cm 기계이앙상자를 20칸으로 구획한 상자에 계통당 20립 정 도씩 파종하여 유리 온실 베드에 치상하였다. 파종 후 15~ 20일경 식물체가 4~5엽까지 자랐을 때 개체당 벼멸구 유충 이 7~10 마리씩 되게 접종하였고, 감수성인 남평벼가 완전 히 고사되었을 때 저항성 여부를 판정하였다(Shin et al. 2011). 벼멸구 성체 검정은 포장에 재식된 공시 재료를 최고 분얼기에 3주씩 플라스틱 상자(78 × 45 × 18 cm)에 이식 후 벼멸구를 접종하여 감수성인 남평벼가 완전히 고사되었을 때 저항성 여부를 판정하였다.
벼흰잎마름병 검정은 공시된 약배양 213계통에 대해서 HB01013 (K1 레이스), HB01009 (K3a) 균주를 이용하여 균계 별로 3주씩 엽선단 약 3 cm 부위를 가위 절엽접종(Kauffman et al. 1973)하여 접종 후 3주 후에 가장 긴 병반을 가진 3개 엽 의 병반장을 측정하여 평균한 값을 이용하였다. 질적 저항성 은 평균 병반장이 5 cm 이하는 저항성(R; resistant), 5~10 cm는 중도저항성(MR; moderately resistant), 10 cm이상은 이병성(S; susceptible)으로 구분하였다(Shin et al. 2011). 선 발된 우량 고정계통에 대해서는 HB01013 (K1), HB01014 (K2), HB01015 (K3), HB01009 (K3a 레이스) 균주를 접종 하여 저항성에 대해 좀더 면밀히 검정하였다.
벼줄무늬잎마름병 검정은 망실을 이용한 대량 검정법으로 바이러스 보독충의 방사 및 계대 사육으로 보독충이 충분히 유지된 망실에서 계통당 1.5g을 조파하였으며, 파종 후 30일 경 이병성 대비품종 일품벼가 병징을 나타낼 때 저항성과 감 수성으로 판정하였다(Kwak et al. 2007).
수량 및 품질 관련 형질 조사
생산력 검정시험에 공시된 재료의 출수기를 조사하고 성숙 기에 시험구별 10개체에 대해서 간장, 수장, 수수를 측정하였 다. 출수 후 45일에 시험구별로 3주를 예취하여 등숙률 및 수 당립수를 측정하고, 수량 조사는 100주를 예취하여 정조수량 을 측정한 다음 이 중 1.5 kg에 대해 정현기로 제영하여 정현 비율을 측정하고, 100주 정조수량에 정현비율을 곱하여 현미 수량을 구하고 10a당 수량으로 환산하였다. 정현된 현미를 가 지고 현미천립중을 측정하였다. 벼흰잎마름병 접종에 따른 시 험에서 대조구와 접종구에서 각각 3주를 예취하여 등숙률을 측정하고, 수량조사는 20주를 3반복으로 예취하여 정조수량 을 측정한 다음 제영하여 현미수량을 측정하였다. 현미 외관 품위 조사는 RN300 (Kett Co., Japan)을 이용하여 정립율을 측정하였고, 단백질 함량은 Infratec 1241 Grain Analyzer (Foss Co., Sweden)를 이용하여 측정하였다.
저항성 유전자 확인
Genomic DNA 추출은 BioSprint 96 (Qiagen Co., Germany) 을 이용하였다. 샘플을 TissueLyserII (Qiagen Co., Germany) 를 이용하여 마쇄한 후 BioSprint 96 DNA Plant Kit (Qiagen Co., Germany)를 이용하여 DNA를 추출하였다. 벼줄무늬잎 마름병 저항성 유전자 Stvb-i, 벼멸구 저항성 유전자 Bph18, 벼흰잎마름병 저항성 유전자 Xa3, Xa4, xa5 를 확인하기 위 해 대상 유전자와 밀접하게 연관된 DNA 분자 마커인 ST10 (Hayano-Saito et al. 2000), 7312.T4A (Jena et al. 2006), 9643.T4, 10571.T14, 10603.T10Dw을 이용하였다(Table 1). PCR은 10 ng의 DNA와 AccuPower® PCR PreMix (Bioneer Co., Korea)를 이용하여 My-Genie 96 Thermal block (Bioneer Co., Korea)에서 수행되었다. PCR 반응은 ST10은 94°C에서 4분간 초기변성 후 94°C 40초, 62°C 30초, 72°C 1분간 총 35회 반복하였고, 7312.T4A는 94°C에서 5분간 초 기변성 후 94°C 30초, 57°C 30초, 72°C 40초간 총 45회 반복 하였고 72°C에서 5분간 반응하였다. 9643.T4와 10571.T14는 94°C에서 5분간 초기변성 후 94°C 40초, 63°C 또는 60°C (10571.T14) 40초, 72°C 1분간 총 40회 반복하였고, 10603. T10Dw은 95°C에서 4분간 초기변성 후 95°C 30초, 65°C 30 초, 72°C 1분간 총 35회 반복하고 72°C에서 5분간 반응하였 다. 증폭된 PCR 산물 4 μl를 7312T4A는 3U Hinf I, 9643.T4는 2U Taqα I와 65°C에서 3시간, 10571.T14는 3U Tsp509 I와 65°C에 2시간, 10603.T10Dw는 Rsa I와 37°C에서 3시간 제한효소 처리하였다. ST10에 의한 증폭 산 물은 제한효소 처리 없이 전기영동에 이용하였다. EtBr이 포 함된 2% agarose gel에서 전기영동 후 UV transilluminator 를 이용하여 유전자형을 판정하였다.
Table 1
Gene-specific PCR primers used for the identification of resistance genes
Table 1
R-genes Chr. No. Marker name Primer sequences
Expected size Reference
Forward (5’-3’), Reverse (5’-3’) (bp)

Stvb-i 11 ST10 CGAAAGATGGTTTCTCCACC 727 Hayano-Saito et. al. (2000)
GACCAAGCAACTAATGACGC
Bph18 12 7312.T4A ACGGCGGTGAGCATTGG 398 Jena et al. (2006)
TACAGCGAAAAGCATAAAGAGTC 566
Xa3 11 9643.T4 AGCCGAGCAATGATACCGACA 290 Jeung et al. (unpublished)
ACAACTGGGATCGAACCGACA
Xa4 11 10571.T14 TGTTGGAGGATTGGCAAGGAA 570 Jeung et al. (unpublished)
TTCGTTGCGGCGTTGTTAATC
xa5 5 10603.T.10Dw GCACTGCAACCATCAATGAATC 280 Jeung et al. (unpublished)
CCTAGGAGAAACTAGCCGTCCA
통계 분석
통계 분석은 SAS 프로그램(Version 9.2, SAS Institute Inc, Cary, North Carolina)을 이용하였다. 저항성 유전자 조 합들의 농업형질에 대한 평균과 표준편차를 기술 통계법으로 구하였고, 평균간 비교는 PROC ANOVA로 분산분석 후 유 의성이 있을 경우 5% 유의수준에서 Duncan’s Multiple Range test (DMRT)로 분석하였다. PROC t-test를 이용하여 K3a 균계 접종에 따른 대조구와 접종구의 형질 변이를 비교하였다.
약배양 계통 육성
약배양에 모부본으로 이용한 HR26234-15-1-1 (이하 HR26234) 과 SR30071-3-7-23-6-2-1-1 (이하 SR30071) 계통의 농업형 질 특성과 병해충 저항성은 Table 2와 같다. SR30071이 HR26234보다 간장이 11 cm 컸고 수장이 길었으며 수수는 적었다. HR26234는 벼흰잎마름병 K1과 K3a 레이스와 벼줄 무늬잎마름병에 저항성을 보였고, SR30071은 벼멸구, 벼흰 잎마름병 K1과 K3a 레이스 및 벼줄무늬잎마름병에 저항성을 나타냈다. HR26234를 모본으로 하고 SR30071을 부본으로 인공 교배하여 F1 29개체를 육성하였다. 각 개체에서 이삭을 채취하여 약배양을 수행하였고 총 213개의 고정계통을 육성 하였다(Table 3).
Table 2
Characteristics of the parents using anther culture
Table 2
Parents Heading date (DASz) Culm length (cm) Panicle length (cm) No. of panicles per hill Reaction to
Resistance genes
rice stripe virus brown plant-hopper bacterial blight
K1 race K3a race

HR26234-15-1-1 104 72 18 13 Ry S R R Xa3+xa5+Stvb-i
SR30071-3-7-23-6-2-1-1 99 83 22 9 R R R R Xa4+Bph18+Stvb-i

zDay after seedling

yR and S mean resistant and susceptible to insect and disease.

Table 3
Anther culture ability and double haploid lines derived from the cross of HR26234-15-1-1/SR30071-3-7-23-6-2-1-1
Table 3
Anther cultured Cali induced Plant regeneration Green plants Albino Double haploid lines
(no.) (no. and %) (no. and %)z (no. and %)y (no. and %)x (no.)w

5,300 1,898 (35.8) 399 (21.0) 232 (58.1) 167 (41.9) 213

zPercent plant regeneration is the number of plants regenerated over number of cali plated

yPercent green is the number of green plants regenerated over total plants regenerated

xPercent albino is the number of albino plants regenerated over total plants regenerated

wDouble haploid lines are harvested plants having fertile grain.

저항성 유전자 확인
목표 유전자와 연관된 DNA 분자 마커를 이용하여 저항성 유 전자를 확인하였다. HR26234는 Xa3+xa5, Stvb-i를 SR30071 은 Bph18, Xa4, Stvb-i를 가지고 있는 것으로 나타났다. 이들 유래 약배양 계통들은 모두 Stvb-i를 가지고 있었고, Bph18 +Xa3, Bph18+Xa4, Bph18+Xa3+xa5, Bph18+Xa4+xa5, bph18+Xa3, bph18+Xa4, bph18+Xa3+xa5bph18+Xa4+xa5 등 총 8개의 유전자 조합이 확인되었다(Fig. 1). Bph18을 가지고 있는 계통은 42계통으로 bph18 계통에 비해 4배 가량 적게 발생하였고, 작성 가능한 벼흰잎마름병 저항성 유전자 조합 중에서 xa5 단독 계통은 발생하지 않았다(Table 4).
Fig. 1.
PCR analysis to confirm the resistance genes using the gene specific DNA markers. Stvb-i, Bph18, Xa3, Xa4, and xa5 was confirmed by PCR product amplified with primer, ST10 (A), 7312.T4A(cleaved by HinfI, B), 9643.T4 (cleaved by TaqαI, C), 10571.T14 (cleaved by Tsp509 I, D), and 10603.T10Dw (cleaved by Rsa I, E), respectively. The white stars represent the lines carrying the resistance genes.
KJBS-46-78_F1.gif
Table 4
Agronomic characteristics of the groups classified by resistance genes combination and their resistance reaction to brown planthopper and bacterial blight
Table 4
Resistance gene
No. of lines Reaction to BPH Reaction to BB
Heading date (DAS) Culm length (cm) Panicle length (cm) No. of panicles per hill Remark
RSVz BPH BB K1 K3a

Stvb-i Bph18 Xa3 10 R R S 112 ± 2.4aby 77.1 ± 3.5bc 19.3 ± 1.7c 9.7 ± 1.3c sterility
Xa4 9 R R 106 ± 1.9abc 80.4 ± 5.0ab 22.0 ± 0.7a 12.1 ± 1.0a
Xa3+xa5 13 R R 113 ± 13.0a 83.7 ± 10.8a 20.6 ± 1.2b 11.9 ± 1.9a sterility
Xa4+xa5 10 R R 101 ± 1.8c 76.8 ± 4.2bc 21.0 ± 0.8b 11.9 ± 1.4a

Total 42 108 ± 8.9A 79.8 ± 7.4A 20.7 ± 1.5A 11.4 ± 1.7A

bph18 Xa3 53 S R S 107 ± 12.5abc 68.4 ± 6.9d 20.4 ± 1.1b 11.8 ± 1.6ab
Xa4 60 R R 104 ± 8.0bc 70.1 ± 7.9d 20.7 ± 1.1b 11.4 ± 1.5ab
Xa3+xa5 51 R R 109 ± 10.abc 70.4 ± 6.2d 20.8 ± 1.4b 11.7 ± 1.6ab
Xa4+xa5 7 R R 103 ± 7.1c 71.8 ± 4.6cd 20.9 ± 0.9b 10.5 ± 1.5bc

Total 171 106 ± 10.3A 69.7 ± 7.0B 20.7 ± 1.2A 11.6 ± 1.6A

zRSV: rice stripe virus, BPH: brown planthopper, BB: bacterial blight

yMeans with same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

약배양 계통의 농업형질 특성 및 병해충 저항성 반응
Bph18 보유 계통은 bph18에 비해서 출수기, 수장, 수수는 차이가 없었으나 간장이 10.1 cm 컸다. Bph18 보유 계통 중 벼흰잎마름병 Xa3Xa3+xa5 조합의 계통은 출수가 늦고 불임이 발생하는 등 열악 형질이 발현되었다. 자포니카형 Bph18 계통은 벼멸구 유묘 저항성에서 Bph1을 가지는 통일 형 다산2호와 Bph3를 가지는 인디카 IR72와 비슷한 수준의 강한 저항성 반응을 나타냈다(Fig. 2). Xa4, Xa3+xa5Xa4 +xa5는 벼흰잎마름병 K1과 K3a레이스에 저항성 반응을 나 타냈다.
Fig. 2.
Resistance reaction of SR30071-3-7-23-6-2-1-1 (A) and double haploid lines (B) derived from the combination of HR26234-15-1-1/SR30071-3-7-23-6-2-1-1 to brown planthopper at seedling stage.
KJBS-46-78_F2.gif
내병충성 계통 선발 및 농업형질 특성
벼멸구 저항성 유전자 Bph18, 벼흰잎마름병 저항성 유전 자 Xa4+xa5, 벼줄무늬잎마름병 저항성 유전자 Stvb-i가 집적 된 7 계통을 선발하여 2012년에 생산력 검정시험을 수행하였 다(Table 5). 출수일수는 96, 97일로 진백(110일), 남평벼 (106), 안미(102)보다 빠른 중생종이었고, 간장은 66~71 cm 로 진백(71 cm), 남평벼(78), 안미(77)보다 짧으며, 수당립수 는 102~118개로 진백(93개), 남평벼(95)보다는 많고 안미 (119)보다는 적었다. 등숙률이 72.0~80.7%로 안미(84.0%), 진백(87.6), 남평벼(90.1)에 비해 낮았고 수량성은 표준품종 인 남평벼에 비해 79~84% 수준으로 낮았다.
Table 5
Yield-related traits of varieties and DH lines at yield trial
Table 5
Var./lines Heading date Culm length Panicle length No. of panicles per hill No. of spikelets per panicle Ratio of ripened grain 1,000 grain weight of brown rice Rough rice yield Brown/rough rice ratio Brown rice yield Index of brown rice yieldy
(DASz) (cm) (cm) (%) (g) (kg/10a) (%) (kg/10a) (%)

Nampyeongbyeo 106bx 78.3a 20.0bc 14 95b 90.1a 20.9ab 647a 79.2 512a 100
Jinbaek 110a 71.4b 20.8b 15 93b 87.6a 21.3a 643a 79.8 513a 100
Anmi 102c 76.5a 22.9a 13 119a 84.0ab 20.3b 674a 79.4 535a 104
HR28869-AC65 96d 65.6d 19.8c 13 102ab 77.8bcd 20.6ab 528b 79.2 419bc 82
HR28869-AC68 96d 67.4bcd 19.9c 13 114a 78.5bcd 20.3b 517b 79.2 410bc 80
HR28869-AC75 96d 67.5bcd 20.3bc 12 118a 80.7bc 21.2a 508b 79.6 404bc 79
HR28869-AC117 97d 70.6bc 20.1bc 12 107ab 78.7bc 20.9ab 527b 79.6 419bc 82
HR28869-AC157 96d 67.0cd 20.0bc 12 114a 74.8cd 21.1a 505b 79.2 400c 78
HR28869-AC158 96d 67.1bcd 20.3bc 12 109ab 79.4bc 21.2a 537b 79.6 428b 84
HR28869-AC159 96d 68.5bcd 20.4bc 12 107ab 72.0d 20.9ab 508b 79.7 405bc 79

zDay after seedling

yBrwon rice yield of Nampyeongbyeo was a standard

xxMeans with the same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

선발계통의 병해충 저항성 성능 검정
선발된 내병충성 계통들은 유묘 및 성체에서 벼멸구에 강 한 저항성을 나타냈으며 벼흰잎마름병 K1, K2, K3, K3a 균 계에 저항성이고 벼줄무늬잎마름병에 강하였다(Table 6, Fig 3, 4). 벼흰잎마름병에 대한 저항성 성능검정을 위해 K3a 균 계 접종한 결과 이병성인 남평벼와 안미는 수량, 등숙률, 현미 정상립률이 대조구에 비해 유의하게 감소한 반면 이들 계통 들은 차이가 나지 않는 경향이었다(Table 7).
Table 6
Reaction of varieties and DH lines to brown planthopper, bacterial blight, and rice stripe virus
Table 6
Var./lines Brown planthopper
Bacterial blight
Rice stripe virus Resistance genes
at seedling at maximum tillering K1 K2 K3 K3a

Nampyeongbyeo Sz S S S S S R Stvb-i
Jinbaek S S R R R R S Xa3+xa5
Anmi R R R R R S R Bph18+Xa3+Stvb-i
HR28869-AC65 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC68 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC75 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC117 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC157 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC158 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC159 R R R R R R R Bph18+Xa4+xa5+Stvb-i

zR and S mean resistant and susceptible to insect and disease.

Fig. 3.
Resistance reaction to brown planthopper. At seedling stage (A). At maximum tillering stage (B). 1: Nampyeongbyeo, 2: Jinbaek, 3: Anmi, 4: HR28869-AC65, 5: HR28869-AC68, 6: HR28869-AC75, 7: HR28869-AC117, 8: HR28869-AC157, 9: HR28869-AC158, 10: HR28869-AC159. Check variety is Nampyeongbyeo.
KJBS-46-78_F3.gif
Fig. 4.
Resistance reaction to bacterial blight, K3a (HB1009 isolate) race. Lesion length at 2 weeks after inoculation (A). Field scenery at maturing stage after inoculation (B). 1: Nampyeongbyeo, 2: Jinbaek, 3: Anmi, 4: HR28869-AC65, 5: HR28869-AC68, 6: HR28869-AC75, 7: HR28869-AC117, 8: HR28869-AC157, 9: HR28869-AC158, 10: HR28869-AC159. White bar indicates 10 cm.
KJBS-46-78_F4.gif
Table 7
Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice
Table 7
Var./lines Control
K3a inoculation
Rough rice yield Brown rice yield Ratio of ripened grain Perfect kernel of brown rice Rough rice yield Brown rice yield Ratio of ripened grain Perfect kernel of brown rice
(g) (g) (%) (%) (g) (g) (%) (%)

Nampyeongbyeo 549 447 87.8 74.5 470**z 378** 79.5** 63.9**
Jinbaek 543 447 85.3 84.2 539ns 443ns 85.0ns 82.2ns
Anmi 554 455 83.7 76.1 490** 399** 71.5** 72.1*
HR28869-AC65 376 304 83.7 72.1 362ns 292ns 81.7ns 70.1ns
HR28869-AC68 445 362 78.1 75.3 417ns 341ns 77.7ns 74.4ns
HR28869-AC75 406 331 73.2 73.7 389ns 318ns 65.6ns 72.4ns
HR28869-AC117 431 352 76.6 73.7 394* 322* 74.6ns 73.6ns
HR28869-AC157 429 352 75.9 73.8 419ns 343ns 70.8ns 72.7ns
HR28869-AC158 450 368 75.7 72.2 419ns 343* 70.2ns 70.9ns
HR28869-AC159 430 352 72.3 73.1 407ns 332* 71.7ns 71.8ns

zns, *, and **mean no significant, significant at P< 0.05, and P< 0.01 by t-test, respectively.

여러 육종방법 중에서 약배양은 육종기간을 단축시키고 분 리집단에서 고정계통을 개발하는데 유용하다(Grewal et al. 2011). 벼흰잎마름병과 벼줄무늬잎마름병에 저항성우량 계통 HR26234-12-1-1 (이하 HR26234)과 벼멸구, 벼흰잎마름병 및 벼줄무늬잎마름병에 저항성인 SR30071-3-7-23-6-2-1-1 (이하 SR30071)계통을 인공 교배한 F1을 약배양하여 총 213 개 고정계통을 조기에 육성하였다(Table 3). DNA 분자 마커 는 마커 활용 선발법(marker-assisted selection; MAS)을 통 해 전통 육종의 효율성과 정확성을 개선할 커다란 가능성을 가지고 있다(Collard and Mackill 2008). 저항성 육종사업에 서 해당 저항성 유전자를 표지하는 분자 마커가 개발되어 있 을 경우 이를 활용하여 저항성 유전자 도입 여부를 초기 세대 부터 확인할 수 있으며 여러 저항성 유전자를 하나의 품종에 집적시킬 수 있다(Dokku et al. 2013, Suh et al. 2013, Xu 2013). 본 연구에서는 벼멸구 저항성 유전자 Bph18에 7312.T4A (Jena et al. 2006), 벼흰잎마름병 저항성 유전자 Xa3, Xa4, xa5에 9643.T4, 10571.T14, 10603.T.10Dw (Jeung et al. unpublished), 벼줄무늬잎마름병 저항성 유전자 Stvb-i에 ST10 (Hayano-Saito et al. 2000)을 이용하여 저항성 유전자 도입 여부를 확인하였다(Fig. 1). HR26234는 Xa3+xa5, Stvb-i을, SR30071은 Bph18, Xa4, Stvb-i를 가지고 있는 것으로 나타 났다. 약배양 유래 계통 중 Bph18을 가지고 있는 계통은 42 계통으로 171개인 bph18 계통에 비해 4배 가량 적게 발생하 였고 작성 가능한 벼흰잎마름병 저항성 유전자 조합 중에서 xa5 단독 계통은 발생하지 않았다. 또한 Bph18+Xa4+xa5+Stvb-i 저항성 유전자 조합의 선발된 7개 내병충성 계통들의 출수기, 간장, 수장, 수당립수, 등숙률 등 농업형질이 비슷한 특성을 나타내어 segregation distortion이 발생한 것으로 생 각된다(Table 4, 5). Segregation distortion은 분리집단에서 멘델의 분리법칙을 따르지 않고 편의 되어서 후대가 생성되 는 것으로 모부본 배우체의 불임에 기인한다든지 특정 배우 체의 유전자형이 선택적으로 수정이 되어서 생성되는 것으로 나눌 수 있다(Xu et al. 1997). 약배양에서 인디카는 약의 조 기사멸, 낮은 캘러스 형성률과 식물체 재분화율 및 잦은 백색 체 발생으로 자포니카에 비하여 저조한 효율을 보이는 것으 로 알려져 있어 생태형에 따라 다르며(Grewal et al. 2011), 불임 관련 유전자들의 작용에 의해 특정 유전자형의 소멸 또 는 약배양 효율이 높은 배우체 유전자형의 선택적 수정으로 인하여 segregation distortion이 발생하는 것으로 보인다.
자포니카 유전자원은 협소한 유전적 배경으로 생물적 스트 레스에 저항성인 유전자를 확보하는데 제한적이다. 이를 보완 하기 위해 인디카의 유용한 유전자를 자포니카로 도입하는데 있어서 전통적 육종법을 활용해서는 높은 불임, 불량한 초형 과 열악형질 수반(linkage drag)으로 어려움이 있다(Jeung et al. 2005). Bph18 저항성 유전자는 야생벼 O.australiensis로 부터 인디카 계통에 이전되었고 MAS기법과 전 게놈의 배경 분석(genome-wide background analysis)을 통해 자포니카 주남벼 배경에 도입되었다(Jena et al. 2006, Suh et al. 2011). Bph18은 12번 염색체 장완에 위치하고 있으며 이 위 치에는 교잡불임과 관련된 대립유전자가 존재한다. Kubo and Yoshimura (2005)는 12번 염색체 장완에서 인디카 품종 IR24와 자포니카 품종 Asominori의 교잡시 불임과 관련된 대립유전자 hsa1-IR을 보고하였고, Yara et al. (2010) 또한 Bph26(t)와 hsa1부근에서 교잡불임과 관련된 hsY(t)가 존재 한다고 하였다. 2011년 육성 당시 Bph18 보유 약배양 계통 중 Xa3Xa3+xa5 조합은 심한 불임을 나타내었으나 SR30071 의 Xa4와 HR26234의 xa5가 결합된 유전자 집적 Xa4+xa5 조합의 계통은 불임에 문제가 없는 것으로 판단되어 선발하 여 생산력검정을 수행하였다. 그러나 2012년 생산력 검정 시 험 중에 Bph18+Xa4+xa5 조합의 계통들에서 불임의 문제점 이 발견되었다(data not shown). 이는 선발과정에서 면밀한 검토가 이루어지지 않았고 2012년 기상이 불임 발현에 영향 을 미친 것으로 생각한다. 자포니카 주남벼 배경으로 Bph18 이 도입된 SR30071 조합의 계통들은 Bph18 표지 마커를 이 용하여 MAS 후 반복적인 여교배를 통해 육성되어 대부분의 게놈이 주남벼로 회복이 되었으나, 여교배 후대 계통들에 대 해서 전 게놈 배경 분석을 실시한 결과 1, 2, 10, 11, 12번 염 색체상에 Bph18 수여친인 인디카 계통 IR65482-7-216-2의 염색체 절편이 남아 있고 이 부위는 여교배 세대 진전에 관계 없이 유지 된다고 하였다(Shin et al. 2011, Suh et al. 2011). 인디카 IR24의 불임관련 대립유전자 hsa1-IR (Chr. 12)는 Asominori의 불임과 관련된 대립유전자 hsa2-As (Chr. 8)와 hsa3-As (Chr. 9)와 한 게놈상에 존재할 경우 심한 불임이 발 생한다(Kubo and Yoshimura 2005). hsa1-IR 발현에 hsa2-As 와 hsa3-As가 상위성(epistasis)을 나타내고 이로 인한 불임 발생은 특정 대립유전자 조합의 선택적 제거를 가져오게 된 다. 따라서 약배양 집단에서 segregation distortion이 발생한 것이나 일부 계통들에서 불임이 발생한 것은 재조합 과정 중 Bph18 부근의 불임 관련 대립유전자와 상위성을 나타내는 다 른 대립유전자들간의 조합에 기인한 것으로 생각한다.
Shin et al. (2011)은 자포니카 벼에 Bph18 도입할 경우 출 수일수는 짧은 쪽으로, 간장과 수장은 큰 쪽으로 작용하며 등 숙비율은 낮은 쪽으로 영향을 미치는 것으로 보인다 하였다. 본 연구에서도 Bph18 도입 계통이 bph18 계통에 비해 간장 이 유의한 수준에서 10.1 cm 컸고 등숙비율은 표준품종과 비 교품종들에 비해 낮았다(Table 4, 5). Bph18이 위치하고 있 는 12번 염색체 장완에는 다른 벼멸구 저항성 유전자 Bph1, bph2, Bph9, Bph10, Bph21, Bph26(t)가 위치하는 것으로 알 려져 있다(Jena and Kim 2010, Murai et al. 2003, Yara et al. 2010). Bph1는 간장을 크게 한다고 하였고 bph2에 의해 간장과 3절간장이 길어져 도복지수가 커진다 하였다(Lee et al. 2005, Yeo and Sohn 2001, Yeo et al. 2002). 이러한 결 과를 종합하여 Shin et al. (2011)은 12번 염색체 장완에 존재 하는 Bph1, bph2, Bph18은 장간 유전자와 밀접히 연관되어 있어 이들 유전자를 가지고 있는 벼 품종들은 재배과정에서 도복 되기 쉬운 특성을 가진 것으로 보인다 하였다. 본 연구 에서는 이러한 도복 관련 문제에 대응하기 위해 단간 위주로 복합내병충성 계통을 선발하여 생산력 검정을 수행하였다. 이 들 계통들은 표준품종인 남평벼와 비교품종인 진백, 안미에 비해서 간장이 작았다(Table 5). 하지만 등숙 후기에 이들 계 통들의 식물체 기부가 기울어서 단간임에도 도복에 안정적이 지 못한 특성이 나타났는데(data not shown). 간장은 줄어들 었으나 상대적으로 3절간장의 길이가 길어 도복에 안정적이 지 못한 것이 아닌가 생각한다.
우리나라 벼흰잎마름병 저항성원으로 많이 활용되고 있는 Xa3는 저항성이 자포니카 일본 품종인 Wase Aikoku 3로부 터 유래하였고 1991년에 저항성 품종인 화영벼와 안중벼가 개발된 이후로 이를 이용하여 많은 우량 품종이 개발되었다 (Kim et al. 2007, Shin et al. 2011). 여교배를 통해 방글라데 시 Aus 품종 DV85의 xa5를 자포니카 수원345호 배경으로 도입한 근동질 유전자 계통이 육성되었고 실질적인 품종 개 발로 이어져 2006년에 강백이 육성되었고 이를 활용하여 Xa3xa5가 결합된 진백(2008)이 개발되어 변이균인 K3a 에 대응할 방안을 마련하였다(Shin et al. 2011). 현재 우리나 라 자포니카 벼흰잎마름병 저항성 육종사업의 목표 유전자 조합은 Xa3xa5가 결합된 Xa3+xa5 조합(Park et al. 2013)으로 이들 조합의 품종으로 진백(2008), 신백(2010), 해 품(2013)이 개발되었으며 저항성 유전자 도입에 따른 열악형 질 수반 문제는 보고된 바가 없다. Xa4는 인디카 품종 TKM6 로 부터 도입되어 인디카 품종의 벼흰잎마름병 저항성원으로 광범위하게 이용되었다(Mew et al. 1992). Suh et al. (2013)는 DNA 분자 마커 활용 여교배법(marker-assisted backcrossing; MAB)을 이용하여 Xa4+xa5+Xa21을 자포니카 품종에 도입 하였고, 이들 도입된 여교배 진전 육성 계통(advanced backcross breeding line; ABL)들은 열악형질이 수반되지 않고 반복친 인 자포니카 품종과 비슷한 농업형질과 품질 특성을 나타낸 다 하였다. 하지만 Xa4는 아직까지 우리나라에서 실질적인 품종 개발에 활용된 적이 없기 때문에 Xa4 도입에 따른 파악 되지 않은 문제점이 발생할 수 있으므로 면밀한 검토가 필요 하다고 생각한다. 우리나라 자포니카 벼 품종의 벼줄무늬잎마 름병 저항성은 인디카 Modan 유래 저항성 유전자 Stvb-i가 도입되어 안정적으로 이용되고 있다(Kwon et al. 2012). 1975년에 최초의 저항성 품종인 낙동벼가 개발(Chung et al. 1975)된 이후로 저항성 품종개발에 Stvb-i이 지속적으로 이용 되고 있으나 Stvb-i 도입에 따른 열악형질 수반 문제는 보고 된 바가 없다.
약배양을 통해 단기간에 벼멸구, 벼흰잎마름병, 벼줄무늬잎 마름병에 저항성인 복합내병충성 계통을 확보할 수 있었다. 하지만 계통 선발 시 파악되지 않았던 불임립의 발생, 낮은 수량성, 단간임에도 도복에 안정적이지 못한 점 등 열악형질 이 발견되었다. 병해충에 대한 저항성 육종사업에서 약배양을 활용하여 조기에 육종 목표를 달성하고자 할 경우에 segregation distortion이 발생하여 편의 된 변이가 발생할 수 있고, 저항 성 유전자 도입 시 linkage drag에 의해 예기치 못한 열악형 질 특성이 나타날 수 있음을 고려하여 신중하게 목표에 접근 하여야 할 것으로 생각한다.
본 연구는 벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에 저항 성인 자포니카 복합내병충성 품종을 조기에 확보하고자 약배 양을 수행하여 목표 저항성 유전자 조합의 우량 고정계통을 개발하고 육성 과정 중에 발생할 수 있는 문제점을 파악하여 병해충 저항성 육종사업에 반영하고자 수행하였다. 벼흰잎마 름병과 벼줄무늬잎마름병에 저항성인 우량 계통 HR26234-12-1-1과 벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에 저항성 인 SR30071-3-7-23-6-2-1-1을 인공 교배한 F1을 약배양하여 213개 고정계통을 육성하였다. HR26234는 Xa3+xa5, Stvb-i, SR30071은 Bph18, Xa4, Stvb-i를 가지고 있는 것으 로 확인되었다. 이들 유래 약배양 계통들은 모두 Stvb-i를 가 지고 있었고, Bph18+Xa3, Bph18+Xa4, Bph18+Xa3+xa5, Bph18+Xa4+xa5, bph18+Xa3, bph18+Xa4, bph18+Xa3+xa5bph18+Xa4+xa5의 조합이 확인되었다. 약배양 집단 에서 xa5+Bph18(또는 bph18)+Stvb-i 조합이 발생하지 않았 고 Bph18 보유 계통이 bph18 보다 적게 발생하는 등 segregation distortion이 발생하였다. Bhp18을 보유하며 벼멸구에 저항성 인 계통들이 감수성인 계통들에 비해 간장이 컸다. 선발된 Bph18+Xa4+xa5+Stvb-i 조합의 계통은 단간이면서 벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에 저항성을 나타내었으나, 낮은 수량성과 일부 불임의 발생, 단간임에도 도복에 안정적 이지 못한 특성을 나타냈다. 병해충에 대한 저항성 육종사업 에서 약배양을 활용하여 조기에 육종 목표를 달성하고자 할 경우에 segregation distortion이 발생하여 편의 된 변이가 발 생할 수 있고, 저항성 유전자 도입 시 linkage drag에 의해 예 기치 못한 열악형질 특성이 나타날 수 있음을 고려하여 신중 하게 목표에 접근하여야 할 것으로 생각한다.
본 논문은 농촌진흥청 연구사업(과제번호: PJ008710)의 지 원에 의해 이루어진 것임.
  • 1. Chung KY, Park RK, Chung KS, Lee SK, Jeon BT, Jin YD. A new high yielding rice variety resistant to rice stripe virus ‘Milyang 15 (Nagdong)’. Res. Rept. NYAES 1975. 17: 17-24.
  • 2. Collard BC, Mackill DJ. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions Royal Soc. B: Biological Sciences 2008. 363: 557-572.
  • 3. Dokku P, Das K, Rao G. Pyramiding of four resistance genes of bacterial blight in Tapaswini, an elite rice cultivar, through marker-assisted selection. Euphytica 2013. 192: 87-96.
  • 4. Grewal D, Manito C, Bartolome V. Doubled haploids generated through anther culture from crosses of elite and cultivars and/or lines of rice: large-scale production, agronomic performance, and molecular characterization. Crop Sci 2011. 51: 2544-2553.
  • 5. Hayano-Saito Y, Saito K, Fujii K, Touyama T, Tsuji T, Sugiura N, Izawa T. SCAR marker selection of the rice stripe resistance gene Stvb-i. Breeding Res 2000. 2: 67-72.
  • 6. Huang D, Qiu Y, Zhang Y, Huang F, Meng J, Wei S, Li R, Chen B. Fine mapping and characterization of BPH27, a brown planthopper resistance gene from wild rice (Oryza rufipogon Griff.). Theor. Appl. Genet 2013. 126: 219-229.
  • 7. Jena KK, Jeung JU, Lee JH, Choi HC, Brar DS. High-resolution mapping of a new brown planthopper (BPH) resistance gene, Bph18(t), and marker-assisted selection for BPH resistance in rice (Oryza sativa L.). Theor. Appl. Genet 2006. 112: 288-297.
  • 8. Jena KK, Kim SM. Current status of brown planthopper (BPH) resistance and genetics. Rice 2010. 3: 161-171.
  • 9. Jeung JJ, Hwang HG, Moon HP, Jena KK. Fingerprinting temperate japonica and tropical indica rice genotypes by comparative analysis of DNA markers. Euphytica 2005. 146: 239-251.
  • 10. Kauffman HE, Reddy APK, Hsieh SPY, Merca SD. An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep 1973. 57: 537-541.
  • 11. Khush G. Multiple disease and insect resistance for increased yield stability in rice. Progress in irrigated rice research 1989. Manila, Philippines, International Rice Research Institute. 79-92.
  • 12. Kim KY, Shin MS, Shin SH, Ko JC, Kim BK, Ko JK, Kim JG. Resistant response of rice varieties to Korean and Philippines’ bacterial blight, Xanthomonas oryzae. pv. oryzae. Korean J. Intl. Agri 2007. 19: 141-146.
  • 13. Kubo T, Yoshimura A. Epistasis underlying female sterility detected in hybrid breakdown in a Japonica–Indica cross of rice (Oryza sativa L.). Theor. Appl. Genet 2005. 110: 346-355.
  • 14. Kwak DY, Yeo US, Lee JH, Oh BG, Shin MS, Ku YC. Mass screening method for rice virus resistance using screen house. Korean J. Crop. Sci 2007. 52: 129-133.
  • 15. Kwon TM, Lee JH, Park SK, Hwang UH, Cho JH, Kwak DY, Youn YN, Yeo US, Song YC, Nam JS, Kang HW, Nam MH, Park DS. Fine mapping and identification of candidate rice genes associated with qSTV11SG, a major QTL for rice stripe disease resistance. Theor. Appl. Genet 2012. 125: 1033-1046.
  • 16. Lee JH, Yeo US, Kwak DY, Park DS, Oh BG, Ku YC, Kim HY, Sohn JG. QTL analysis for ripening traits of BPH resistant backcross inbred lines in rice. Korean J. Breed. Sci 2005. 37: 295-299.
  • 17. Lee JH, Yeo US, Cho JH, Lee JY, Song YC, Shin MS, Kang HW, Sohn JK. Marker assisted selection of brown planthopper resistance and development of multi-resistance to insect and disease in rice (Oryza sativa L.). Korean J. Breed. Sci 2011. 43: 413-421.
  • 18. Mew T, Vera CCM, Medalla E. Changes in race frequency of Xanthomonas oryzae pv. oryzae in response to rice cultivars planted in the Philippines. Plant Dis 1992. 76: 1029-1032.
  • 19. Murai H, Sharma P, Murata K, Hashimoto Z, Ketipearachi Y, Shimizu T, Takumi S, Mori N, Kawasaki S, Nakamura C. Constructing linkage maps of brown planthopper resistance genes Bph1, bph2, and Bph9 on rice chromosome 12. Rice genetics collection 2003. Singapore, World Scientific Publishing. 263-265.
  • 20. Park HS, Shin MS, Kim KY, Noh TH, Baek SH, Lee JH, Ha KY, Baek MK, Kim WJ, Park JH, Yoo JS, Cho YC, Kim BK. Reaction of single resistance genes and their pyramiding effects in indica and japonica rice against Xanthomonas oryzae pv. oryzae in Korea. Korean J. Breed. Sci 2013. 45: 119-129.
  • 21. Savary S, Teng PS, Willocquet L, Nutter FW Jr.. Quantification and modeling of crop losses: a review of purposes. Annu. Rev. Phytopathol 2006. 44: 89-112.
  • 22. Shin MS, Kim KY, HS P, Ko JK. Breeding for resistance to bacterial blight in rice. Korean J. Breed. Sci 2011. 43: 251-261.
  • 23. Shin MS, Kim WJ, Shin WC, Park HS, Seo CS, Choi IB, Ha KY, Kang HJ, Ko JK. Effect of brwon planthopper resistance gene, Bph18 to yield components in rice. Korean J. Breed. Sci 2011. 43: 56-61.
  • 24. Suh J-P, Yang S-J, Jeung J-U, Pamplona A, Kim J-J, Lee J-H, Hong H-C, Yang C-I, Kim Y-G, Jena KK. Development of elite breeding lines conferring Bph18 gene-derived resistance to brown planthopper (BPH) by marker-assisted selection and genome-wide background analysis in japonica rice (Oryza sativa L.). Field Crop. Res 2011. 120: 215-222.
  • 25. Suh J-P, Jeung J-U, Noh T-H, Cho Y-C, Park S-H, Park H-S, Shin M-S, Kim C-K, Jena KK. Development of breeding lines with three pyramided resistance genes that confer broad-spectrum bacterial blight resistance and their molecular analysis in rice. Rice 2013. 6: 1-11.
  • 26. Xu J. Pyramiding of two BPH resistance genes and Stv-bi gene using marker-assisted selection in japonica rice. Crop Breed. Appl. Biot 2013. 13: 99-106.
  • 27. Xu Y, Zhu L, Xiao J, Huang N, McCouch S. Chromosomal regions associated with segregation distortion of molecular markers in F2, backcross, doubled haploid, and recombinant inbred populations in rice (Oryza sativa L.). Mol. Gen. Genet 1997. 253: 535-545.
  • 28. Yara A, Phi CN, Matsumura M, Yoshimura A, Yasui H. Development of near-isogenic lines for BPH25(t) and BPH26(t), which confer resistance to the brown planthopper, Nilaparvata lugens (Stål.) in indica rice ‘ADR52’. Korean J. Breed. Sci 2010. 60: 639-647.
  • 29. Yeo US, Sohn JG. Linkage analysis between some agronomic traits and resisatnce gene to brown planhopper in rice. Korean J. Breed. Sci 2001. 33: 287-293.
  • 30. Yeo US, Kwak DY, Lim SJ, Ha WG, Cho JH, Sohn JG. Relationship between agronomic traits and resistance to brown planthopper in Japonica RIL population. Korean J. Breed. Sci 2002. 34: 148-152.
  • 31. Yoshimura S, Yoshimura A, Iwata N, McCouch SR, Abenes ML, Baraoidan MR, Mew TW, Nelson RJ. Tagging and combining bacterial blight resistance genes in rice using RAPD and RFLP markers. Mol. Breeding 1995. 1: 375-387.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice
Korean. J. Breed. Sci.. 2014;46(1):78-89.   Published online March 31, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice
Korean. J. Breed. Sci.. 2014;46(1):78-89.   Published online March 31, 2014
Close

Figure

  • 0
  • 1
  • 2
  • 3
Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice
Image Image Image Image
Fig. 1. PCR analysis to confirm the resistance genes using the gene specific DNA markers. Stvb-i, Bph18, Xa3, Xa4, and xa5 was confirmed by PCR product amplified with primer, ST10 (A), 7312.T4A(cleaved by HinfI, B), 9643.T4 (cleaved by TaqαI, C), 10571.T14 (cleaved by Tsp509 I, D), and 10603.T10Dw (cleaved by Rsa I, E), respectively. The white stars represent the lines carrying the resistance genes.
Fig. 2. Resistance reaction of SR30071-3-7-23-6-2-1-1 (A) and double haploid lines (B) derived from the combination of HR26234-15-1-1/SR30071-3-7-23-6-2-1-1 to brown planthopper at seedling stage.
Fig. 3. Resistance reaction to brown planthopper. At seedling stage (A). At maximum tillering stage (B). 1: Nampyeongbyeo, 2: Jinbaek, 3: Anmi, 4: HR28869-AC65, 5: HR28869-AC68, 6: HR28869-AC75, 7: HR28869-AC117, 8: HR28869-AC157, 9: HR28869-AC158, 10: HR28869-AC159. Check variety is Nampyeongbyeo.
Fig. 4. Resistance reaction to bacterial blight, K3a (HB1009 isolate) race. Lesion length at 2 weeks after inoculation (A). Field scenery at maturing stage after inoculation (B). 1: Nampyeongbyeo, 2: Jinbaek, 3: Anmi, 4: HR28869-AC65, 5: HR28869-AC68, 6: HR28869-AC75, 7: HR28869-AC117, 8: HR28869-AC157, 9: HR28869-AC158, 10: HR28869-AC159. White bar indicates 10 cm.
Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice

Gene-specific PCR primers used for the identification of resistance genes

R-genes Chr. No. Marker name Primer sequences
Expected size Reference
Forward (5’-3’), Reverse (5’-3’) (bp)

Stvb-i 11 ST10 CGAAAGATGGTTTCTCCACC 727 Hayano-Saito et. al. (2000)
GACCAAGCAACTAATGACGC
Bph18 12 7312.T4A ACGGCGGTGAGCATTGG 398 Jena et al. (2006)
TACAGCGAAAAGCATAAAGAGTC 566
Xa3 11 9643.T4 AGCCGAGCAATGATACCGACA 290 Jeung et al. (unpublished)
ACAACTGGGATCGAACCGACA
Xa4 11 10571.T14 TGTTGGAGGATTGGCAAGGAA 570 Jeung et al. (unpublished)
TTCGTTGCGGCGTTGTTAATC
xa5 5 10603.T.10Dw GCACTGCAACCATCAATGAATC 280 Jeung et al. (unpublished)
CCTAGGAGAAACTAGCCGTCCA

Characteristics of the parents using anther culture

Parents Heading date (DASz) Culm length (cm) Panicle length (cm) No. of panicles per hill Reaction to
Resistance genes
rice stripe virus brown plant-hopper bacterial blight
K1 race K3a race

HR26234-15-1-1 104 72 18 13 Ry S R R Xa3+xa5+Stvb-i
SR30071-3-7-23-6-2-1-1 99 83 22 9 R R R R Xa4+Bph18+Stvb-i

Day after seedling

R and S mean resistant and susceptible to insect and disease.

Anther culture ability and double haploid lines derived from the cross of HR26234-15-1-1/SR30071-3-7-23-6-2-1-1

Anther cultured Cali induced Plant regeneration Green plants Albino Double haploid lines
(no.) (no. and %) (no. and %)z (no. and %)y (no. and %)x (no.)w

5,300 1,898 (35.8) 399 (21.0) 232 (58.1) 167 (41.9) 213

Percent plant regeneration is the number of plants regenerated over number of cali plated

Percent green is the number of green plants regenerated over total plants regenerated

Percent albino is the number of albino plants regenerated over total plants regenerated

Double haploid lines are harvested plants having fertile grain.

Agronomic characteristics of the groups classified by resistance genes combination and their resistance reaction to brown planthopper and bacterial blight

Resistance gene
No. of lines Reaction to BPH Reaction to BB
Heading date (DAS) Culm length (cm) Panicle length (cm) No. of panicles per hill Remark
RSVz BPH BB K1 K3a

Stvb-i Bph18 Xa3 10 R R S 112 ± 2.4aby 77.1 ± 3.5bc 19.3 ± 1.7c 9.7 ± 1.3c sterility
Xa4 9 R R 106 ± 1.9abc 80.4 ± 5.0ab 22.0 ± 0.7a 12.1 ± 1.0a
Xa3+xa5 13 R R 113 ± 13.0a 83.7 ± 10.8a 20.6 ± 1.2b 11.9 ± 1.9a sterility
Xa4+xa5 10 R R 101 ± 1.8c 76.8 ± 4.2bc 21.0 ± 0.8b 11.9 ± 1.4a

Total 42 108 ± 8.9A 79.8 ± 7.4A 20.7 ± 1.5A 11.4 ± 1.7A

bph18 Xa3 53 S R S 107 ± 12.5abc 68.4 ± 6.9d 20.4 ± 1.1b 11.8 ± 1.6ab
Xa4 60 R R 104 ± 8.0bc 70.1 ± 7.9d 20.7 ± 1.1b 11.4 ± 1.5ab
Xa3+xa5 51 R R 109 ± 10.abc 70.4 ± 6.2d 20.8 ± 1.4b 11.7 ± 1.6ab
Xa4+xa5 7 R R 103 ± 7.1c 71.8 ± 4.6cd 20.9 ± 0.9b 10.5 ± 1.5bc

Total 171 106 ± 10.3A 69.7 ± 7.0B 20.7 ± 1.2A 11.6 ± 1.6A

RSV: rice stripe virus, BPH: brown planthopper, BB: bacterial blight

Means with same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

Yield-related traits of varieties and DH lines at yield trial

Var./lines Heading date Culm length Panicle length No. of panicles per hill No. of spikelets per panicle Ratio of ripened grain 1,000 grain weight of brown rice Rough rice yield Brown/rough rice ratio Brown rice yield Index of brown rice yieldy
(DASz) (cm) (cm) (%) (g) (kg/10a) (%) (kg/10a) (%)

Nampyeongbyeo 106bx 78.3a 20.0bc 14 95b 90.1a 20.9ab 647a 79.2 512a 100
Jinbaek 110a 71.4b 20.8b 15 93b 87.6a 21.3a 643a 79.8 513a 100
Anmi 102c 76.5a 22.9a 13 119a 84.0ab 20.3b 674a 79.4 535a 104
HR28869-AC65 96d 65.6d 19.8c 13 102ab 77.8bcd 20.6ab 528b 79.2 419bc 82
HR28869-AC68 96d 67.4bcd 19.9c 13 114a 78.5bcd 20.3b 517b 79.2 410bc 80
HR28869-AC75 96d 67.5bcd 20.3bc 12 118a 80.7bc 21.2a 508b 79.6 404bc 79
HR28869-AC117 97d 70.6bc 20.1bc 12 107ab 78.7bc 20.9ab 527b 79.6 419bc 82
HR28869-AC157 96d 67.0cd 20.0bc 12 114a 74.8cd 21.1a 505b 79.2 400c 78
HR28869-AC158 96d 67.1bcd 20.3bc 12 109ab 79.4bc 21.2a 537b 79.6 428b 84
HR28869-AC159 96d 68.5bcd 20.4bc 12 107ab 72.0d 20.9ab 508b 79.7 405bc 79

Day after seedling

Brwon rice yield of Nampyeongbyeo was a standard

xMeans with the same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

Reaction of varieties and DH lines to brown planthopper, bacterial blight, and rice stripe virus

Var./lines Brown planthopper
Bacterial blight
Rice stripe virus Resistance genes
at seedling at maximum tillering K1 K2 K3 K3a

Nampyeongbyeo Sz S S S S S R Stvb-i
Jinbaek S S R R R R S Xa3+xa5
Anmi R R R R R S R Bph18+Xa3+Stvb-i
HR28869-AC65 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC68 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC75 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC117 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC157 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC158 R R R R R R R Bph18+Xa4+xa5+Stvb-i
HR28869-AC159 R R R R R R R Bph18+Xa4+xa5+Stvb-i

R and S mean resistant and susceptible to insect and disease.

Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice

Var./lines Control
K3a inoculation
Rough rice yield Brown rice yield Ratio of ripened grain Perfect kernel of brown rice Rough rice yield Brown rice yield Ratio of ripened grain Perfect kernel of brown rice
(g) (g) (%) (%) (g) (g) (%) (%)

Nampyeongbyeo 549 447 87.8 74.5 470**z 378** 79.5** 63.9**
Jinbaek 543 447 85.3 84.2 539ns 443ns 85.0ns 82.2ns
Anmi 554 455 83.7 76.1 490** 399** 71.5** 72.1*
HR28869-AC65 376 304 83.7 72.1 362ns 292ns 81.7ns 70.1ns
HR28869-AC68 445 362 78.1 75.3 417ns 341ns 77.7ns 74.4ns
HR28869-AC75 406 331 73.2 73.7 389ns 318ns 65.6ns 72.4ns
HR28869-AC117 431 352 76.6 73.7 394* 322* 74.6ns 73.6ns
HR28869-AC157 429 352 75.9 73.8 419ns 343ns 70.8ns 72.7ns
HR28869-AC158 450 368 75.7 72.2 419ns 343* 70.2ns 70.9ns
HR28869-AC159 430 352 72.3 73.1 407ns 332* 71.7ns 71.8ns

ns, *, and **mean no significant, significant at P< 0.05, and P< 0.01 by t-test, respectively.

Table 1 Gene-specific PCR primers used for the identification of resistance genes
Table 2 Characteristics of the parents using anther culture

Day after seedling

R and S mean resistant and susceptible to insect and disease.

Table 3 Anther culture ability and double haploid lines derived from the cross of HR26234-15-1-1/SR30071-3-7-23-6-2-1-1

Percent plant regeneration is the number of plants regenerated over number of cali plated

Percent green is the number of green plants regenerated over total plants regenerated

Percent albino is the number of albino plants regenerated over total plants regenerated

Double haploid lines are harvested plants having fertile grain.

Table 4 Agronomic characteristics of the groups classified by resistance genes combination and their resistance reaction to brown planthopper and bacterial blight

RSV: rice stripe virus, BPH: brown planthopper, BB: bacterial blight

Means with same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

Table 5 Yield-related traits of varieties and DH lines at yield trial

Day after seedling

Brwon rice yield of Nampyeongbyeo was a standard

xMeans with the same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

Table 6 Reaction of varieties and DH lines to brown planthopper, bacterial blight, and rice stripe virus

R and S mean resistant and susceptible to insect and disease.

Table 7 Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice

ns, *, and **mean no significant, significant at P< 0.05, and P< 0.01 by t-test, respectively.