Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

유전자 보유 키다리병 중도저항성 중만생 내도복 다수성 찰벼 신품종 ‘진옥(眞玉)찰’

조수민, 강주원, 이지윤, 조준현, 권영호, 이소명, 최지수, 정종민, 김우재, 이종희, 박동수*

Development of a Mid-late Glutinous Rice Cultivar. ‘Jinokchal,’ a Variety Resistant to Bakanae Disease Harboring the qBK1 Gene

Korean Journal of Breeding Science 2025;57(3):271-278.
Published online: September 1, 2025

국립식량과학원 밭작물개발부 경지이용작물과

Field Crop Research Division, NICS, RDA, Milyang, Republic of Korea

*Corresponding to Dong-Soo ParkTEL. +82-55-350-1165E-mail. parkds9709@korea.kr
• Received: May 7, 2025   • Revised: May 28, 2025   • Accepted: July 8, 2025

Copyright © 2025 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 223 Views
  • 1 Download
prev next
  • Bakanae disease, caused by various Fusarium species, poses a significant threat to global rice production, with its incidence increasing in major rice-producing regions. Currently, no rice varieties exhibit complete resistance to this disease. Enhancing resistance in rice cultivars could serve as a cost-effective and sustainable alternative to fungicide application. Developing resistant rice varieties may offer a practical solution to mitigate yield losses and reduce dependency on chemical treatments. ‘Jinokchal’ was derived from the cross between ‘Milyang299’, which harbors bakanae disease-resistant QTL qBK1. and ‘Baekokchal’ in 2014. A promising line, YR31624-5B-2, was then selected and designated as ‘Milyang366’ in 2019. The local adaptability test of ‘Milyang366’ was conducted at five locations from 2020 to 2022, and the cultivar was subsequently named ‘Jinokchal. ’ The heading date of ‘Jinokchal’ was August 13, classifying it as a medium-late maturing cultivar. The culm was 77 cm long and had 108 spikelets per panicle. The 1,000 grain-weight of brown rice is 22.7 g, which is heavier than that of ‘Sinseonchalbyeo’. This variety is resistant to blast, rice stripe virus, and bacterial blight, but susceptible to insect pests. The yield potential of ‘Jinokchal’ was approximately 497 kg/10a at the ordinary fertilizer level in the local adaptability test over three years. ‘Jinokchal’ is moderately resistant to bakanae disease and harbors the qBK1 gene derived from the tong-il type rice ‘Shingwang’ (Registration No. 8135).
키다리병은 1828년 일본에서 처음 보고된 이후(Ito & Kimura 1931), 아시아와 아프리카를 비롯한 대부분의 벼 재배 지역에서 발생하며(Ou 1985, Pra et al. 2010), 현재도 주요 병해로 여겨지고 있다. 이 병은 주로 F. andiyazi, F. fujikuroi, F. proliferatum, F. verticillioidesGibberella fujikuroi 복합군에 속하는 균류에 의해 유발된다(Wulff et al. 2010). 종자 및 토양 전염성을 가지는 키다리병은 감염된 벼에서 줄기가 길고 가늘어지며, 황록색을 띠고, 출수 이후 불임률이 증가하여 수량 감소를 초래한다(Mew & Gonzales 2002, Ou 1985).
키다리병은 최근 기계이앙과 상자육묘의 확산, 하이브리드 벼 재배 증가로 인해 세계적으로 발생이 더욱 확대되는 추세이다(Rosales & Mew 1997, Yang et al. 2003). 국내에서도 2000년대 초반까지만 해도 벼 재배지의 약 3%에서 발생하던 것이 2006년 28.8% (Han 2007), 2013년 31%까지 증가한 후 후 매년 벼 농가에 피해를 주고 있다. 키다리병에 대한 가장 확실하고 경제적인 방제 대책으로는 저항성 품종을 재배하는 것이나 현재까지 국내 밥쌀용 품종 중에는 ‘안평’, ‘남평’, ‘새누리’, ‘영진’ 등 키다리병에 어느 정도 견디는 품종이 개발돼 있으나, 찰벼 등 가공용 품종에는 저항성 품종이 없는 실정이다.
최근 연구에서는 국내 육성 품종을 활용한 저항성 유전자 탐색이 이루어진 결과, 통일형 벼 품종인 ‘신광’으로부터 저항성 QTL qBK1이 밝혀졌고(Hur et al. 2015, Lee et al. 2019), 이를 일반계 찰벼 품종으로 도입한 키다리병 중도 저항성 찰벼 품종인 ‘진옥찰’을 개발한 바 이 품종의 육성경위 및 주요특성을 보고하는 바이다.
시험재료
본 시험은 벼 품종 ‘진옥찰’ 육성을 위해 2020~2022년 3년간 밀양, 전주 등 5개 지역에서 보통기 보비 표준재배로 수행하였다. 시비량 및 질소분시 방법은 농촌진흥청 표준재배법에 준하였다. 재식거리 30⨯15 cm로 주당 3본씩 이앙하였다. 기타 재배방법 및 수량성, 생리장해 특성 및 병충해 저항성 및 품질분석 조사는 농촌진흥청 신품종개발공동연구사업 과제수행계획서 조사기준에 준하였다.
키다리병 저항성 검정
벼 키다리병 저항성 검정은 기존 연구(Kim et al. 2014)를 참고하여 수행하였다. 실험에 사용된 Gibberella fujikuroi CF283 균주는 2012년 농촌진흥청 국립농업과학원에서 분양받았으며, 해당 균주를 potato dextrose agar (PDA) 배지에 접종한 후 28℃에서 명 조건으로 3주간 배양하였다. 배양된 균사체는 증류수에 현탁하여 포자 현탁액을 제조하였으며, 최종 포자농도가 1×106 spores/ml이 되도록 희석하여 접종에 활용하였다.
균 접종에 앞서, 각 품종당 30립의 종자를 Tissue Embedding Cassette (Simport, M512, 40.1×28.5×13 mm)에 넣고 57℃에서 13분간 온탕 처리하여 종자 소독을 실시하였다. 소독 후 종자는 찬물에서 식힌 뒤 준비된 포자 현탁액에 침지하고, 26℃에서 4일간 배양하면서 매일 4회 이상 Cassette를 천천히 회전시켜 포자가 종자 전체에 균일하게 접종되도록 하였다. 이후 접종된 종자는 육묘용 상자에 품종당 30립씩 배치하여 파종하였다. 실험의 균일성을 확보하기 위해 비교 품종으로 ‘주남’과 ‘남평’을 함께 파종하여 상대적인 저항성을 평가하는 기준으로 활용하였다.
저항성 평가는 Kim et al. (2014)의 방법을 변형하여 실시하였으며, 이앙 후 1개월 시점에서 품종별 총 식물체 수 대비 이병주의 비율을 측정하였다. 또한, 육안 관찰을 통해 저항성 정도를 1(저항성)에서 9(감수성)까지의 범위로 구분하여 평가하였다.
Genomic DNA 추출 및 PCR
Genomic DNA를 추출하기 위하여 어린 벼 잎 3~4장을 2 mL tube에 3 mm 텅스텐 구슬 3개와 함께 넣고 액체질소에 5~10분간 침적시킨 다음 vortex하여 마쇄하였다. 마쇄된 샘플은 Chen & Ronald (1999)의 방법을 참고하여 cetyltrimethyl ammonium bromide (CTAB)법을 이용해 genomic DNA를 분리하였으며, 이후 PCR 분석에 활용하였다. 품종별 키다리병 저항성 유전자형 분석에는 통일형 벼인 ‘신광’에서 유래한 벼 키다리병 저항성 QTL (qBK1)을 표지하는 분자마커 InDel19-14 (Lee et al. 2019, Forward primer; CAGAGTGCCCCAATGGAACA, reverse primer; GTTGCCGCACCCGACGCCCT)를 사용하였다. PCR 반응은 94℃에서 30초간 변성(denaturation), 55℃에서 30초간 결합(annealing), 72℃에서 60초간 신장(extension) 과정을 포함한 40 cycles로 수행하였다. 증폭된 PCR 산물은 3% agarose gel에서 전기영동한 후 EtBr 염색을 통해 genotype을 분석하였다.
육성경위
벼 품종 ‘진옥찰’은 통일형 벼 품종 ‘신광’으로부터 qBK1 유전자가 도입된 자포니카형 고품질 찰벼 품종 육성을 위해 '14 하계에 ‘신광’에 일반형 밥쌀용 고품질 품종인 ‘일품’이 6회 여교배된 ‘밀양299호’를 모본으로 하고 ‘백옥찰’을 부본으로 교배를 실시한 후 계통육종법으로 육성되었다. 2015년 하계에 F1세대 24개체로부터 얻은 종자를 이용하여 2015년 동계 F2세대 세대단축 등을 통하여 2018년 F7세대 14계통을 전개한 후 포장에서 계통육종법에 의해 선발하면서 PCR을 통해 qBK1 유전자를 보유하는 계통 중 생육특성이 우수한 계통을 선발하였다. 선발된 계통에 대해 2019년 생산력검정시험을 실시한 결과 YR31624-5B-2 계통을 선발하여 ‘밀양366호’로 계통명을 부여하고 2020~2022년 3년간 지역적응시험 실시한 결과 그 우수성이 인정되어 2022년 12월 농촌진흥청 농작물 직무육성 신품종선정위원회에서 키다리병 저항성 보유 품종으로 중요성과 활용성이 인정되어 품종으로 선정하고 ‘진옥찰’로 명명하였다(Figs. 1, 2).
주요특성

1. 출수기 및 주요 농업적 특성

‘진옥찰’의 출수기는 영호남 평야지에서 보통기 보비 재배시 영호남 5개소 평균 8월 13일로 ‘신선찰벼’보다 늦은 중만생종이다. 벼 키는 77 cm로 ‘신선찰벼’보다 작으며 포기당 이삭수는 15개로 ‘신선찰벼’보다 적고, 이삭당 벼알 수는 108개로 ‘신선찰벼’와 비슷하다. ‘진옥찰’의 등숙비율과 현미 천립중은 각각 85.2%와 22.7 g으로 ‘신선찰벼’보다 유의적으로 높다(Table 1).

2. 생리장해 저항성

‘진옥찰’은 성숙기 하엽노화가 표준품종인 ‘신선찰벼’와 비슷하다. 냉수처리에 의한 내냉성 검정 결과 ‘신선찰벼’의 출수지연 일수와 냉수구 임실률이 각각 13일과 23.4%로 ‘신선찰벼’와 비슷하였다. 수발아율은 8.5%로 ‘신선찰벼’보다 유의적으로 낮았다(Table 2). 도복특성 검정에서 ‘진옥찰’의 벼 키, 3절간장이 ‘신선찰벼’보다 짧아 좌절중이 높아 도복지수가 109로 ‘신선찰벼’보다 낮았다. 포장도복 정도 역시 이앙재배에서 ‘신선찰벼’보다 강하였다(Table 3).

3. 병해충 저항성

전국 11개 장소에서 잎도열병 밭못자리 검정 결과 ‘진옥찰’의 저항성은 평균 4.7로 ‘신선찰벼’(평균 2.3)보다 약한 편이었으며, 목도열병은 ‘신선찰벼’와 비슷한 정도의 강한 저항성을 나타냈다(Table 4). 벼줄무늬잎마름병과 흰잎마름병(K1~K3)에는 강하나 멸구류에는 저항성이 없다.
‘진옥찰’에 대한 통일형 벼인 ‘신광’ 유래 저항성 QTL인 qBK1 도입 여부를 확인하기 위해 qBK1를 표지하는 분자마커 Indel19-14 (Lee et al. 2019)를 이용하여 PCR을 수행한 결과, 모든 개체에 저항성 QTL인 qBK1이 분리없이 도입된 것을 확인하였으며(Fig. 3), 키다리병 저항성 검정에서도 중도 이상의 저항성을 나타내었다(Fig. 4).

4. 미질 특성

‘진옥찰’의 도정률과 현미 장폭비는 각각 74.3%와 1.82 ‘신선찰벼’와 비슷하였다. 아밀로스와 단백질도 각각 5.0% 및 6.9%로 ‘신선찰벼’와 비슷하다(Table 5).

5. 수량성

‘진옥찰’의 백미 수량은 2020년부터 2022년까지 전주, 밀양 등 영호남 5개 지역에서 보통기 보비재배의 3년 평균 497 kg/10a로 대비품종인 ‘신선찰벼’와 비슷하였다(Table 6).
벼 품종 ‘진옥찰’은 통일형 벼 품종 ‘신광’으로부터 qBK1 유전자가 도입된 자포니카형 고품질 찰벼 품종 육성을 위해 2022년 국립식량과학원 남부작물부에서 육성한 품종이다. ‘진옥찰’은 '14 하계에 신광에 일반형 밥쌀용 고품질 품종인 ‘일품’이 6회 여교배된 ‘밀양299호’를 모본으로 하고 ‘백옥찰’을 부본으로 교배를 실시한 후 계통육종법으로 육성되었다. 선발된 YR31624-5B-2 계통을 ‘밀양366호’로 계통명을 부여하고 2020~2022년 3년간 지역적응시험 실시하였다. ‘진옥찰’의 출수기는 영호남 평야지에서 보통기 보비 재배시 영호남 5개소 평균 8월 13일로 ‘신선찰벼’보다 늦은 중만생종이다. 벼 키는 77 cm로 ‘신선찰벼’보다 작으며 포기당 이삭수는 15개로 ‘신선찰벼’보다 적고, 이삭당 벼알 수는 108개로 ‘신선찰벼’와 비슷하다. ‘진옥찰’의 등숙비율과 현미 천립중은 각각 85.2%와 22.7 g으로 ‘신선찰벼’보다 유의적으로 높다. 도복, 도열병, 벼줄무늬잎마름병 및 흰잎마름병(K1~K3)에 강하나 해충에 약한 편이다. ‘진옥찰’은 통일형 벼 품종인 ‘신광’으로 부터 유래한 키다리병 저항성 QTL인 qBK1을 보유하여 키다리병에 중도 이상의 저항성을 보인다.
‘진옥찰’의 쌀수량은 497 kg/10a로 대비품종인 ‘신선찰벼’와 비슷하였다. ‘진옥찰’의 현미 장폭비는 1.82로 ‘신선찰벼’와 비슷하며 아밀로스와 단백질도 각각 5.0% 및 6.9%로 ‘신선찰벼’와 비슷한 고품질 찰벼이다.
본 논문은 농촌진흥청 연구사업(세부과제명: 산업체 맞춤형 용도별 가공용 육종 소재 개발, 세부과제번호: PJ017383042025)의 지원에 의해 이루어진 것임. ‘진옥찰’을 육성함에 있어 적극 협력하여 주신 국립식량과학원 품종개발과와 중북부작물연구센터 및 각 도 농업기술원 벼지역적응시험 담당자분들과 농촌진흥청 연구정책국 관계관 여러분들께 깊은 감사를 드린다.
Fig. 1
Pedigree diagram of ‘Jinokchal’.
kjbs-57-3-271-f1.jpg
Fig. 2
Generation diagram of ‘Jinokchal’.
kjbs-57-3-271-f2.jpg
Fig. 3
Allele type of ‘Jinokchal’ using a InDel marker InDel19-14 related to bakanae disease resistance.
kjbs-57-3-271-f3.jpg
Fig. 4
Level of reistance of ‘Jinokchal’ under artificial infection of G. fujikuroi iisolate CF283 in seedling stage. Ilpum (S), Anpyeong (MR), Baekokchal (S), Jinokchal (MR).
kjbs-57-3-271-f4.jpg
Table 1
Major agronomic traits and yield components of ‘Jinokchal’.
Table 1
Variety Heading
date
Culm length (cm) Panicle length (cm) No of
panicles / hill
No of
spikes / panicles
Ratio of ripened grain (%) 1000-grain weight of brown rice (g)
Jinokchal Aug. 18 77* 21ns 15* 108ns 85.2* 22.7*
Sinseonchalbyeo Aug. 6 89 22 18 101 68.2 21.1

*: significant at 5% level, ns: no significant.

Statistical differences between means were analyzed using Microsoft Excel (Microsoft Corporation, Redmond, WA, USA).

Table 2
Abiotic stress response of ‘Jinokchal’.
Table 2
Variety Leaf senescence
at maturing
Discolorationz (1~9) Cold tolerancey Viviparous germination (%)

Heading delay (day) Grain fertility (%)
Jinokchal Medium 4 13ns 23.4ns 8.5**
Sinseonchalbyeo Medium 5 14 17.0 48.3

*: significant at 5% level, **: significant at 1% level, ns: no significant.

zEvaluation at maximum tillering stage (1: tolerant, 9: susceptible) for measuring growth status, fertilizer management, uniformity of plant development.

yCold tolerance was evaluated at cold water (17℃) irrigation nursery in Chuncheon.

Table 3
Major characteristics related to lodging of ‘Jinokchal’.
Table 3
Variety Plant height
(cm)
Third internode length (cm) Breaking strength
(g)
Lodgingz index Lodging in
the field (1~9)
Jinokchal 103 7.8 1,993 109 1
Sinseonchalbyeo 127 17.4 1,040 215 7

zLodging index: (plant height×top fresh weight)/Breaking strength.

Table 4
Resistance reaction to blast disease and bacterial blight.
Table 4
Variety Reaction at blast nursery testz Baterial blight

Number of tested sitesy Neck blast (infected spikes, %)x


R
(0~3)
M
(4~6)
S
(7~9)
M
ean
M
ilyang
Yesan Jeonju Yeoju K1 K2 K3 K3a
Jinokchal 2 5 4 4.7 0.0 0.6 0.0 1.1 R R R S
Sinseonchalbyeo 9 2 0 2.3 0.1 3.7 0.0 0.0 S S S S

zN fertilizer of blast nursery test: 240 kg/ha.

yR: resistance, M: moderately resistance, S: susceptible.

xN fertilizer of neck blast: 220 kg/ha.

Table 5
Grain quality of ‘Jinokchal’.
Table 5
Variety Milling recovery (%) Length/width ratio of brown rice Broken rice
(%)
Amylose
(%)
Protein
(%)
Alkali digestion
(1~7)
Jinokchal 74.3 1.82ns 1.5 5.0ns 6.9ns 6.0ns
Sinseonchalbyeo 72.0 1.95 3.3 5.1 6.1 5.5

*, ns: no significant at 5% level.

Table 6
Yield of ‘Jinokchal’ at local adaptability test on ordinary season culture.
Table 6
Culture season Tested
site
Yield of milled rice (kg/10a) Index
(A/B)

Jinokchal Sinseonchalbyeo


'20 '21 '22 Ave (A) '20 '21 '22 Ave (B)
Honam plain region Jeonju 435 474 420 443 418 472 491 460 96
Yesan 498 547 486 510 511 551 491 518 99
Iksan 490 580 392 487 506 527 568 534 91
Naju 512 570 522 535 455 483 515 484 110

Yeongnam plain region Milyang 491 574 479 509 484 538 468 497 102

Mean 485 549 460 497 475 514 507 499 100

*: ns: no significant at 5% level.

  • 1. Chen DH, Ronard PC. 1999. A rapid DNA mini-preparation method suitable for AFLP and other PCR application. Plant Mol Biol Rep 17: 53-57.
  • 2. Han S. 2007. Review of disease occurrence of major crops in Korea in 2007. Proceedings of Annual Falling Meeting and Symposium of KSPP 19-20.
  • 3. Hur YJ, Lee SB, Kim TH, Kwon T, Lee JH, Shin DJ, Park SK, Hwang UH, Cho JH, Yoon YN, Yeo US, Song YC, Kwak DY, Nam MH, Park DS. 2015. Mapping of qBK1, a major QTL for bakanae disease resistance in rice. Mol Breeding 35: 78. doi:10.1007/s11032-015-0281-x.
  • 4. Ito S, Kimura J. 1931. Studies on the 'bakanae' disease of the rice plant. Report of the Hokkaido National Agricultural Experiment Station 27: 1-95.
  • 5. Kim MH, Hur YJ, Lee SB, Kwon TM, Hwang UH, Park SK, Yoon YN, Lee JH, Cho JH, Shin DJ, Kim TH, Han SI, Yeo US, Song YC, Nam MH, Park DS. 2014. Large-scale screening analysis for the evaluation of bakanae disease in rice. J Gen Plant Pathol 80: 408-414.
  • 6. Lee SB, Kim N, Hur YJ, Cho SM, Kim TH, Lee JY, Cho JH, Lee JH, Song YC, Seo YS, Ko JM, Park DS. 2019. Fine mapping of qBK1, a major QTL for bakanae disease resistance in rice. Rice 12: 36. doi:10.1186/s12284-019-0295-9.
  • 7. Mew TW, Gonzales PG. 2002. A handbook of rice seedborne fungi. International Rice Research Institute. Los Baňos (Philippines) and Science Publishers, Inc., Enfield.
  • 8. Ou SH. 1985. Rice diseases. 2nd edn. Commonwealth Mycological Institute, Kew.
  • 9. Pra MD, Tonti S, Pancaldi D, Nipoti P, Alberti I. 2010. First report of fusarium andiyazi associated with rice bakanae in Italy. Plant Dis 94: 1070-1070.
  • 10. Rosales AM, Mew TW. 1997. Suppression of fusarium moniliforme in rice by rice-associated antagonistic bacteria. Plant Dis 81: 49-52.
  • 11. Wulff EG, Sørensen JL, Lübeck M, Nielsen KF, Thrane U, Torp J. 2010. Fusarium spp. Associated with rice bakanae: Ecology, genetic diversity, pathogenicity and toxigenicity. Environ Microbiol 12: 649-657.
  • 12. Yang H, Wang Z, Wu H, Zhu C. 2003. Study on the variation of rice bakanae under the different methods of seedling raising. J Anhui Agric Sci 31: 119-124.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Development of a Mid-late Glutinous Rice Cultivar. ‘Jinokchal,’ a Variety Resistant to Bakanae Disease Harboring the qBK1 Gene
Korean. J. Breed. Sci.. 2025;57(3):271-278.   Published online September 1, 2025
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Development of a Mid-late Glutinous Rice Cultivar. ‘Jinokchal,’ a Variety Resistant to Bakanae Disease Harboring the qBK1 Gene
Korean. J. Breed. Sci.. 2025;57(3):271-278.   Published online September 1, 2025
Close

Figure

  • 0
  • 1
  • 2
  • 3
Development of a Mid-late Glutinous Rice Cultivar. ‘Jinokchal,’ a Variety Resistant to Bakanae Disease Harboring the qBK1 Gene
Image Image Image Image
Fig. 1 Pedigree diagram of ‘Jinokchal’.
Fig. 2 Generation diagram of ‘Jinokchal’.
Fig. 3 Allele type of ‘Jinokchal’ using a InDel marker InDel19-14 related to bakanae disease resistance.
Fig. 4 Level of reistance of ‘Jinokchal’ under artificial infection of G. fujikuroi iisolate CF283 in seedling stage. Ilpum (S), Anpyeong (MR), Baekokchal (S), Jinokchal (MR).
Development of a Mid-late Glutinous Rice Cultivar. ‘Jinokchal,’ a Variety Resistant to Bakanae Disease Harboring the qBK1 Gene

Major agronomic traits and yield components of ‘Jinokchal’.

Variety Heading
date
Culm length (cm) Panicle length (cm) No of
panicles / hill
No of
spikes / panicles
Ratio of ripened grain (%) 1000-grain weight of brown rice (g)
Jinokchal Aug. 18 77* 21ns 15* 108ns 85.2* 22.7*
Sinseonchalbyeo Aug. 6 89 22 18 101 68.2 21.1

Abiotic stress response of ‘Jinokchal’.

Variety Leaf senescence
at maturing
Discolorationz (1~9) Cold tolerancey Viviparous germination (%)

Heading delay (day) Grain fertility (%)
Jinokchal Medium 4 13ns 23.4ns 8.5**
Sinseonchalbyeo Medium 5 14 17.0 48.3

Major characteristics related to lodging of ‘Jinokchal’.

Variety Plant height
(cm)
Third internode length (cm) Breaking strength
(g)
Lodgingz index Lodging in
the field (1~9)
Jinokchal 103 7.8 1,993 109 1
Sinseonchalbyeo 127 17.4 1,040 215 7

Resistance reaction to blast disease and bacterial blight.

Variety Reaction at blast nursery testz Baterial blight

Number of tested sitesy Neck blast (infected spikes, %)x


R
(0~3)
M
(4~6)
S
(7~9)
M
ean
M
ilyang
Yesan Jeonju Yeoju K1 K2 K3 K3a
Jinokchal 2 5 4 4.7 0.0 0.6 0.0 1.1 R R R S
Sinseonchalbyeo 9 2 0 2.3 0.1 3.7 0.0 0.0 S S S S

Grain quality of ‘Jinokchal’.

Variety Milling recovery (%) Length/width ratio of brown rice Broken rice
(%)
Amylose
(%)
Protein
(%)
Alkali digestion
(1~7)
Jinokchal 74.3 1.82ns 1.5 5.0ns 6.9ns 6.0ns
Sinseonchalbyeo 72.0 1.95 3.3 5.1 6.1 5.5

Yield of ‘Jinokchal’ at local adaptability test on ordinary season culture.

Culture season Tested
site
Yield of milled rice (kg/10a) Index
(A/B)

Jinokchal Sinseonchalbyeo


'20 '21 '22 Ave (A) '20 '21 '22 Ave (B)
Honam plain region Jeonju 435 474 420 443 418 472 491 460 96
Yesan 498 547 486 510 511 551 491 518 99
Iksan 490 580 392 487 506 527 568 534 91
Naju 512 570 522 535 455 483 515 484 110

Yeongnam plain region Milyang 491 574 479 509 484 538 468 497 102

Mean 485 549 460 497 475 514 507 499 100
Table 1 Major agronomic traits and yield components of ‘Jinokchal’.

*: significant at 5% level, ns: no significant.

Statistical differences between means were analyzed using Microsoft Excel (Microsoft Corporation, Redmond, WA, USA).

Table 2 Abiotic stress response of ‘Jinokchal’.

*: significant at 5% level, **: significant at 1% level, ns: no significant.

zEvaluation at maximum tillering stage (1: tolerant, 9: susceptible) for measuring growth status, fertilizer management, uniformity of plant development.

yCold tolerance was evaluated at cold water (17℃) irrigation nursery in Chuncheon.

Table 3 Major characteristics related to lodging of ‘Jinokchal’.

zLodging index: (plant height×top fresh weight)/Breaking strength.

Table 4 Resistance reaction to blast disease and bacterial blight.

zN fertilizer of blast nursery test: 240 kg/ha.

yR: resistance, M: moderately resistance, S: susceptible.

xN fertilizer of neck blast: 220 kg/ha.

Table 5 Grain quality of ‘Jinokchal’.

*, ns: no significant at 5% level.

Table 6 Yield of ‘Jinokchal’ at local adaptability test on ordinary season culture.

*: ns: no significant at 5% level.