Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

프로토파낙사디올 강화 GM벼의 주요 농업 특성 비교 평가

김나연1, 장예진1, 박종찬1, 이성곤1, 장안철1, 백소현2, 최용의3, 정남진4, 윤도원1, 오성덕1,*

Comparative Evaluation of Major Agronomic Traits of Protopanaxadiol-enriched GM Rice

Korean Journal of Breeding Science 2025;57(3):205-215.
Published online: September 1, 2025

1농촌진흥청 국립농업과학원 생물안전성과

2순천대학교 웰빙자원학과

3강원대학교 산림자원학전공

4전북대학교 농학과

1Biosafety Division, National Institute of Agricultural Sciences, Rural Development Administration, Jeonju, 54874, Republic of Korea

2Department of Agricultural Life Science, Sunchon National University, Suncheon, 59722, Republic of Korea

3Department of Forest Resources, College of Forest and Environmental Sciences, Kangwon National University, Chuncheon, 24341, Republic of Korea

4Department of Crop Science and Biotechnology, Jeonbuk National University, Jeonju, 54896, Republic of Korea

*Corresponding to Sung-Dug OhTEL. +82-63-238-4735E-mail. ohbaboh@korea.kr
• Received: April 3, 2025   • Revised: June 6, 2025   • Accepted: July 9, 2025

Copyright © 2025 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 257 Views
  • 8 Download
  • 1 Crossref
next
  • Genetically modified (GM) crops have been developed to enhance various agronomic traits and increase the production of functional compounds. In the present study, the major agronomic characteristics of protopanaxadiol (PPD)-enriched GM rice, which was developed by introducing dammarenediol-II synthase (PgDDS) and protopanaxadiol synthase (CYP716A47) genes from Panax ginseng into Oryza sativa cv. Dongjin, were evaluated. The stability of the introduced genes was confirmed using PCR and immunostrip tests, which showed consistent expression across multiple generations (T5-T7). Agronomic traits, including days to heading, culm length, panicle length, tiller number, and grain weight per plant, were compared between GM rice and its non-GM counterpart, Dongjin rice. No significant differences were observed for these traits, indicating that genetic modification did not affect the overall plant growth. However, seed morphology analyses revealed that PPD-enriched GM rice had significantly longer brown rice grains. In contrast, other seed traits remained within the natural range of commercial rice varieties. Furthermore, PPD was consistently detected in GM rice, whereas it was absent in non-GM Dongjin rice. These findings suggest that PPD-enriched GM rice maintains a stable agronomic performance while successfully accumulating PPD, supporting its potential as a functional crop. However, further research is required to evaluate its environmental impact, food safety, and efficacy as a functional food source.
유전자 변형(genetically modified; GM) 작물은 농업 목적으로 사용되는 식물로, 유전 공학 과정을 통해 원하는 형질을 암호화하는 하나 또는 여러 개의 유전자가 삽입된 것이다. GM 작물의 상업적 이용은 1990년대 중반부터 시작되었으며, 그 이후로 이 기술은 전 세계로 빠르게 확산되었다(Qaim 2009). GM 작물의 전 세계 면적은 1996년 170만 헥타르에서 2019년 1억 9,040만 헥타르로 약 112배 증가했으며, 총 29개국에서 재배되었다. 29개국에서 가장 많이 채택된 GM 작물은 대두로 전 세계 GM 작물 면적의 48.2%를 차지하였으며, 그다음으로 옥수수, 면화, 유채 순이었다. 형질전환 작물이 개발되고 상업화를 승인받은 주요 형질에는 제초제 내성, 해충 저항성, 내병성 등이 있으며, 제초제 내성과 해충 저항성 형질을 동시에 갖는 GM 작물은 2019년에 전 세계 생명공학 작물 재배 면적의 45%를 차지하였다(ISAAA 2019). 이처럼 GM작물의 상업화가 진행되면서 제초제 내성, 해충 저항성 등 생산자 중심의 농업형질 개선에 중점을 두었다면, 현재는 농민과 소비자에게 이익이 되는 방향으로 연구개발이 이루어지고 있다(Cho et al. 2020). GM벼에는 수량성 증대, 병해충 저항성, 가뭄 내성 및 신기능성 물질 생산 등에 대한 형질전환 기술들이 활용되고 있다(Jeong et al. 2013). 기능성 물질을 생산하는 GM작물 연구 결과를 보면, Ha et al. (2010)은 고추(Capsicum annuum)의 카로티노이드(carotenoid)의 대사 발현 시 다중유전자를 동시 발현시켜 쌀의 배유 부위에 발현시킨 베타카로틴 생합성 벼(비타민A 강화벼)를 개발하였고, Baek et al. (2013)은 대사증후군 및 관련 질환 예방에 효과가 있는 레스베라트롤을 생산하는 형질전환 벼를 개발하였다. 또한, 인삼에서 유래한 사포닌을 생합성 하는 형질전환 벼는 Han et al. (2019)에 의해 개발되었다.
인삼(Panax ginseng C.A. Meyer)은 동아시아지역, 특히 한국과 중국에서 신체 활력을 유지하기 위해 중요한 한약재로 오랫동안 사용되어왔다(Yun 2001). 인삼의 주요 약리 활성 성분은 진세노사이드라고 불리는 트리테르펜(triterpene) 사포닌이다(Shibata et al. 1965, Tansakul et al. 2006). 진세노사이드는 아글리콘(aglycone) 구조에 따라 dammarane type 및 oleanane type으로 분류된다. 그 중, 주요 진세노사이드인 dammarane type은 프로토파낙사디올(protopanaxadiol; PPD)과 프로토파낙사트리올(protopanaxatriol)을 포함한다(Tansakul et al. 2006). 프로토파낙사디올은 dammarenediol-II 합성 유전자(PgDDS)와 protopanaxadiol 합성 유전자(CYP716A47)에 의해 생성되며, 글리코실화 후 최종적으로 triterpene glycosides (ginsenosides)로 전환된다(Han et al. 2019, Shibata 2001). 프로토파낙사디올은 광범위한 약리학적 활성을 가지고 있다(Han et al. 2019). PPD는 항암 및 항종양(Gao et al. 2013), 항비만(Kim et al. 2019), 항당뇨(Deng et al. 2017) 및 항우울(Chen et al. 2022) 효과가 보고되었다. Han et al. (2019)이 개발한 인삼 유래 사포닌 생합성 GM벼의 종자 추출물은 항산화 및 항멜라노제닉 효과(Monmai et al. 2023a) 및 지방 생성과 염증 반응을 억제하여 항비만 효과(Monmai et al. 2023b) 및 골다공증을 유도하는 파골세포를 억제하는데 유용한 기능성 식품이나 치료제로 적용될 수 있다고 보고되었다(Lee et al. 2022).
일반 종자와 달리 GM 작물의 상용화를 위해서는 위해성 평가가 필수적이다(Park et al. 2018). 우리나라 안전성 평가 심사의 시작은 1999년 유전자변형 콩이며, 2000년에 유전자변형식품을 최초로 승인하였다. 현재까지 우리나라에서 상업적인 재배가 승인된 유전자변형식품은 없지만, 2024년 7월 기준으로 제초제 내성, 해충 저항성 등의 특성을 가진 옥수수, 콩, 면화 및 유채 등을 포함하여 총 247건을 유전자변형식품으로 승인되었다(Kang 2019, MFDS 2024). GM 작물의 위해성 평가는 환경 위해성과 식품 안전성으로 구분되며, OECD 및 FAO/WHO 가이드라인에 근거하여 수행된다(EFSA Panel on GMO 2010, FAO/WHO 1996, OECD 1993). 이를 위해 GM 작물과 기존 non-GM 작물 간의 유사점과 차이점을 분석하는 비교 접근법이 적용되며, 핵심 개념으로 실질적 동등성이 활용된다. 비교 평가 항목에는 분자생물학적 특성, 농업적 및 표현형적 특성, 그리고 성분 분석이 포함되며, 유사한 환경 조건에서 재배된 GM 작물과 대조군을 비교하는 방식으로 진행된다(EFSA Panel on GMO 2010). 또한, 비교 평가에서 관찰된 차이를 식물 특성의 자연적 변이 범위 내에서 해석하기 위해, GM 계통 및 기존 대응 품종(conventional counterpart)뿐만 아니라 non-GM 참조 품종도 포장시험에 포함되어야 한다(EFSA Panel on GMO 2015). 본 연구에서는 PPD 강화 GM벼의 도입유전자인 dammarenediol-II 합성 유전자(PgDDS) 및 protopanaxadiol 합성 유전자(CYP716A47)의 T5-T7 세대별 안정성 분석을 하였다. 또한, GM벼의 모본인 동진벼와 함께 참조품종인 니폰바레 및 안미를 포함하여 농업적 특성을 비교 평가하여 GM벼의 위해성 평가를 위한 기초자료로 활용하고자 연구를 수행하였다.
실험 재료
인삼 유래 유전자인 dammarenediol-II 합성 유전자(PgDDS)와 protopanaxadiol 합성 유전자(CYP716A47)가 동시에 발현되는 사포닌 생합성 벼(Han et al. 2019)와 이의 모본인 동진벼를 2021년부터 2023년까지 국립농업과학원 전주 LMO (Living modified organisms) 격리 재배 포장(RDA-가AB-2013-041)에서 재배하였다(T5-T7). 참조품종인 니폰바레 및 안미는 2021년 및 2022년에 동일한 포장에서 재배하였다. 시험 재료인 PPD 강화 GM벼와 동진벼는 2021년 5월 6일에 파종 후 2021년 6월 4일에 포장에 이앙하였고, 2022년에는 4월 25일 파종 후 2022년 5월 24일에 이앙하였으며, 2023년에는 5월 7일에 파종 후 2023년 6월 5일에 이앙하였다. 이앙은 3반복으로 무작위 배치하였으며, 각 반복별 재배 면적은 4×5 m이었다. 재식거리는 30×15 cm로 주당 1본씩 재식하였다. 시비량 등 기타 재배법은 농촌진흥청 표준재배법에 따라 실시하였다.
도입유전자의 인접 염기서열 분석 및 Immunostrip 검정
PPD 강화 GM벼의 genomic DNA에 도입된 T-DNA의 인접서열을 확인하고자 flanking T-DNA sequencing을 실시하였다. PPD 강화 GM벼의 genomic DNA를 HincⅡ로 절단하고, adaptor를 부착하였다. 그 다음, T-DNA right border에 대해서 RB1과 RB2를 제작하고 left border에 대해서는 LB1과 LB2의 프라이머를 제작하여 단계별로 PCR을 수행하였다(Table 1). 이후 증폭된 산물을 1% agarose gel에 전기영동 한 후, HiYield Gel/PCR DNA Extraction Kit (RBC, Taiwan)를 사용하여 정제하고 ABI3730XL 시스템을 이용하여 시퀀싱 하였다. 삽입된 T-DNA의 유전체 내 위치를 확인하기 위해 Gramene 데이터베이스(http://www.gramene.org)를 활용하여 인접서열을 검색하였다. Immunostrip 검정은 글루포시네이트(glufosinate) 저항성 유전자인 bar 유전자를 검출할 수 있는 Trait LL Test Strip (Strategic Diagnostics Inc, Newark, DE) 이용하여 실시하였다.
Genomic DNA 추출 및 PCR 검정
PPD 강화 GM벼(T5-T7)및 동진벼 잎을 각 0.1 g씩 취한 후 막자사발을 이용하여 액체질소로 마쇄하였다. DNeasy Plant Kit (Qiagen, Valencia, CA)를 이용하여 프로토콜에 따라 genomic DNA를 추출한 후 NanoDrop Spectrophotometer ND-1000 (NanoDrop Technologies Inc, Wilmington, DE)을 이용하여 260/280 nm 값이 1.8~2.0 사이인 추출액을 실험에 사용하였다. PPD 강화 GM벼(T5-T7)와 동진벼 잎을 1차 증류수와 함께 마쇄하여 단백질을 추출한 후, bar 유전자의 발현을 Trait LL Test Strip (Strategic Diagnostics Inc, Newark, DE)을 이용하여 확인하였다. PCR 검정을 위해 bar 유전자 특이적 프라이머, 인삼 유래 사포닌 생합성 유전자인 PgDDSCYP716A47, 내재유전자로 SPS 유전자를 사용하였다(Table 2). PCR 검정 시 PCR 기기(T-100TM Thermal cycler (Biorad, USA)를 이용하여 DNA 변성 및 94℃ 30초, 57℃ 30초, 72℃ 30초의 조건으로 30회 반복한 후 72℃에서 5분간 반응하였고, bar 유전자 특이적 프라이머는 94℃에서 5분간 DNA 변성 및 94℃ 30초, 60℃ 30초, 72℃ 30초의 조건으로 30회 반복한 후 72℃에서 5분간 반응하였다. 증폭된 PCR 산물은 2% 아가로스겔을 이용한 전기영동법으로 확인하였다.
주요 생육 특성 및 종자 특성 평가
PPD 강화 GM벼 및 동진벼의 생육 특성 조사는 농촌진흥청 연구조사 분석기준을 참고하여(RDA 2012) 출수일수, 간장, 수장, 분얼수, 1주 무게를 조사하였다. 출수일수는 파종일부터 출수기까지의 일수를 측정하였다. 간장은 지면에서 이삭목까지의 길이를 측정하였고, 수장은 까락을 제외한 이삭목에서 이삭 끝까지의 길이를 측정하였다. 분얼수는 주간을 제외하고 2엽 이상 전개된 분얼 개수를 조사하였다. 1주당 무게는 수확 후 탈곡한 종자의 무게를 측정하였다. 간장, 수장, 분얼수, 1주 무게는 반복당 10주를 측정하였다. 입장 및 입폭은 반복당 20립을 측정하였고, 천립중은 10반복을 측정하였다. 장폭비는 입장을 입폭으로 나눈 값으로 계산하였다. 현미는 인습기(Kett Electric Laboratory Co. Ltd., Tokyo, Japan)을 이용하여 왕겨를 분리하였다.
Protopanaxadiol 함량 분석
분쇄된 현미 시료 100 mg에 100% methanol을 첨가한 후 40℃에서 30분 동안 초음파 처리를 하였다. 원심분리 후 얻어진 상층액은 주입 전 수집하였다. 추출물은 Shimadzu LC system (Kyoto, Japan)을 이용하여 분석하였으며, 컬럼은 YMC-Pack Pro C18 RS (150×2.0 mm. D, S-5 µm, 8 nm, YMC Co., Ltd., Japan)를 사용하였다. 컬럼 온도는 40℃로 설정하였다. Liquid chromatograph-mass spectrometry ion trap/ time-of-fight (LCMS-IT-TOF) (Shimadzu, Kyoto, Japan)은 positive and/or negative ion mode에서 atmospheric pressure chemical ionization (APCI) 소스를 장착하였다. 표준 Protopanaxadiol는 위와 같은 조건에서 수행하였으며, LC 및 LCMS-IT-TOF 분석의 자세한 프로토콜은 Han et al. (2019)에서 사용한 방법과 동일하다(Kim et al. 2024).
통계 분석
통계 분석은 SPSS (23.0.0 for Windows, Rel. 23.0, 2015. SPSS Inc., Chicago, USA)를 사용하였으며, 일원분산분석(One-way ANOVA) 및 Duncan’s multiple range test (DMRT)를 5% 유의수준에서 처리평균간 유의성 검정을 수행하였다.
PPD 강화 GM벼의 도입유전자 확인
PPD 강화 GM벼는 인삼(Panax ginseng C.A.Meyer)에서 유래한 dammarenediol-II synthase (PgDDS) 및 protopanaxadiol 합성 유전자(CYP716A47)를 벼 배유 특이적 α-글로불린 프로모터를 이용하여 동진벼에 도입하여 공동 발현되도록 개발되었다(Han et al. 2019). 본 연구에서는 벼 종자에서 PPD 함량이 증가된 PPD 강화 GM벼의 복수세대(T5~T7)에 걸쳐 도입유전자를 확인하였다. PPD 강화 GM벼의 T-DNA는 사포닌 생합성 유전자인 PgDDSCYP716A47, 개시인자(PGlb, P35S), 종결인자(TPINⅡ, T35S, 3’nos), 선발마커(bar)로 구성되어 있다(Fig. 1). 도입유전자의 인접 염기서열 분석을 통해 삽입 위치를 확인한 결과, 벼 게놈 내의 1번 염색체의 26,434,421번과 26,434,491번 염기서열 사이에 삽입되어 있음을 확인하였으며, 해당 삽입 부위는 Os01t0653500-00 유전자의 5’upstream 1000에 위치하였다.
선발마커인 글루포시네이트(glufosinate) 저항성 유전자 bar를 이용하여 0.5% 글루포시네이트 암모늄 처리와 immunostrip 검정을 실시하였다. PPD 강화 GM벼 및 동진벼에 0.5% 글루포시네이트 암모늄을 처리한 후 8일째 확인한 결과, 동진벼는 고사한 반면, PPD 강화 GM벼는 제초제(글루포시네이트 암모늄) 처리에 영향을 받지 않았다(Fig. 2). Immunostrip 검정 결과, 동진벼를 제외한 모든 PPD 강화 GM 벼에서 양성 반응을 확인할 수 있었다(Fig. 3A). 또한, PCR 분석을 통해 PPD 강화 GM 벼의 모든 세대에서 글루포시네이트 저항성 유전자와 인삼 유래 사포닌 생합성 유전자인 PgDDSCYP716A47이 검출되었다(Fig. 3B). 이러한 결과는 PPD 강화 GM벼의 세대가 진전되어도 도입유전자의 발현이 안정적으로 유지되고 있음을 확인하였다.
주요 생육 특성 비교 평가
PPD 강화 GM벼와 모품종인 동진벼, 참조품종인 안미 및 니폰바레의 주요 생육 특성 조사 결과를 Table 3에 나타내었다. 동진벼의 출수일수는 108±7.0일, PPD 강화 GM벼의 출수일수는 109±7.0일로 모본인 동진벼보다 1일 늦게 출수하였다. 참조품종인 안미 및 니폰바레와 비교했을 때 GM벼의 출수일은 약간 지연되는 경향을 보였으나, 통계적 유의차는 보이지 않았다. Kantayos et al. (2021)의 연구에서는 레스베라트롤 강화벼와 모본인 동진벼의 출수일수를 비교한 결과, 세 지역(수원, 익산, 밀양)에서 모두 GM벼가 동진벼보다 늦게 출수한다고 보고하였다. 또한, Lee et al. (2021)은 가뭄내성벼와 모본인 일미벼의 출수일수를 비교한 결과, 모본보다 가뭄내성벼가 늦게 출수한다고 보고하였다. 벼의 출수기는 유전적 요인과 재배 환경의 상호작용에 따라 결정되며, 이는 수량 및 품질에 영향을 미친다(Song et al. 2024, Wei et al. 2020). 출수기는 광주기 반응과 관련된 복잡한 유전자 네트워크뿐만 아니라, 후성유전학적 조절과 외부 환경 요인에 따라 조절된다. 그러나, 이와 관련된 분자적 조절 메커니즘은 여전히 명확히 규명되지 않은 부분이 많다(Song et al. 2024).
간장, 수장, 분얼수 및 1주당 무게를 조사한 결과, GM벼 및 모본인 동진벼 간의 통계적 유의한 차이는 관찰되지 않았다(p>0.05). 간장은 동진벼보다 GM벼가 더 짧았으며, 수장은 두 품종 모두 20.2 cm로 같았다. 동진벼를 모본으로 한 11계통의 형질전환 벼들의 간장은 73~91 cm로 보고된 바 있다(Jeong et al. 2013). 분얼수는 동진벼의 분얼수가 GM벼에 비해 많았으며, 1주당 무게는 동진벼가 GM벼보다 더 무거웠다. 참조품종 중 안미는 간장 및 수장에서 나머지 품종들과 유의한 차이를 보였다(p<0.05). 조사한 항목들 중 출수일수 및 간장은 국내 육성 294개 품종 조사 범위 내에 포함되었으며(Lee et al. 2020), 수장 및 분얼수는 국내 육성 243개 품종 조사 범위 내에 포함되었다(Kim et al. 2016). 결과적으로, 도입유전자로 인한 PPD 강화 GM벼와 동진벼 간의 주요 생육 특성 차이는 보이지 않는 것으로 판단된다.
종자 특성 비교 평가
PPD 강화 GM벼와 동진벼, 참조품종의 현미 특성 조사 결과를 Table 4에 나타내었다. GM벼의 입장은 모본인 동진벼보다 유의하게 길었으며, 입폭은 더 짧았다. 이는 PPO (protoporphyrinogen oxidase) 저해 제초제 내성 형질전환 벼에서 모품종에 비해 입장이 길게 나타났다는 기존 결과와 일치한다(Go et al. 2013). 종자의 장폭비는 입장을 입폭으로 나눈 값으로, GM벼의 장폭비가 동진벼보다 유의하게 높았으며, 입장 및 장폭비 모두 두 품종 간 통계적으로 유의한 차이가 나타났다(p<0.05). 이를 통해 PPD 강화 GM벼의 입형은 모본인 동진벼보다 상대적으로 장립형인 것으로 확인되었다. 천립중은 GM벼에서 24.00±0.45 g, 동진벼에서 24.47±0.15 g으로 측정되었으며, 두 품종 간에 유의한 차이는 나타나지 않았다. 가뭄내성 및 PPO 저해 제초제 내성 형질전환 벼의 경우에도 천립중이 모품종보다 감소하는 경향이 있었지만, 통계적으로 유의하지 않았다(Dhungana et al. 2015, Go et al. 2013). 정리하면, PPD 강화 GM벼는 모품종에 비해 입장이 더 길고, 입폭은 더 좁았으며, 천립중은 모품종과 유사한 수준으로 나타났다. 또한, GM벼의 종자 특성들은 국내 재배품종의 종자 특성 범위 내에 포함되었다(Lee et al. 2012). 그러나 대부분의 농업적 특성은 유전적 요인 외에도 기상 조건을 비롯한 다양한 환경 요인의 영향을 크게 받는다. 따라서 다양한 재배 지역에서 농업 형질 분석이 필요할 것으로 판단된다.
Protopanaxadiol 함량 분석
PPD 강화 GM벼의 세대별 PPD 함량을 분석하였으며, 이를 통해 GM벼 현미에서 PPD가 안정적으로 발현됨을 확인하였다(Table 5). 동진벼 현미에서는 PPD가 검출되지 않았지만, GM벼 현미(T5-T7)에서는 PPD가 검출되었으며, 세대가 진전되어도 PPD 함량이 유지되는 경향을 보였다. 이는 PPD 생합성 관련 유전자가 GM벼 내에서 후대에서도 지속해서 유지되어 안정적으로 발현됨을 보여준다. 세대별 PPD 평균 함량(16.4±1.3 µg/g DW)은 비교적 일정하게 유지되었으며 특히, 2022년도에 재배한 T6세대에서 가장 높은 PPD 함량(17.5±1.6 µg/g DW)이 확인되었다. 이러한 차이는 환경적 요인이나 생육 조건에 따라 나타날 수 있다. 식물의 사포닌 함량은 가변적이며 온도, 습도 및 토양 비옥도와 같은 주변 환경의 영향을 받아 정량적 함량과 정성적 조성이 변할 수 있다(Szakiel et al. 2011). 향후 연구에서는 다양한 재배 지역에서 PPD 함량 변화를 평가함으로써, GM벼의 기능성 성분 발현이 환경적 요인의 영향을 받는 양상을 이해할 수 있을 것이다.
따라서, 본 연구 결과는 PPD 강화 GM벼의 유전적 안정성과 지속적인 PPD 발현 가능성을 평가하는 데 기초자료를 제공하며, 향후 농업적 유용성 및 기능성 강화 GM작물 개발을 위한 연구의 기반이 될 것으로 기대된다. 추후 연구에서는 다양한 재배 지역에서의 PPD 함량 변화를 추가로 분석함으로써 기능성 유용 물질 생산 GM벼의 실용화 및 가공적성 가능성 등을 연구할 필요가 있다.
본 연구는 인삼 유래 dammarenediol-II 합성 유전자(PgDDS) 및 protopanaxadiol 합성 유전자(CYP716A47)를 도입한 PPD 강화 GM벼의 주요 농업적 특성을 평가하였다. PCR 및 immunostrip 검정을 통해 도입유전자가 T5~T7 세대에서도 안정적으로 발현됨을 확인하였다. PPD 강화 GM벼와 모본인 동진벼의 출수일수, 간장, 수장, 분얼수, 1주당 무게를 비교한 결과, 통계적으로 유의한 차이를 보이지 않았으며, 이는 유전자 도입이 벼의 전반적인 생육 특성에 큰 영향을 미치지 않았음을 시사한다. 그러나 종자 형태 분석에서는 GM벼의 입장 및 장폭비가 모품종에 비해 유의미하게 길었으며, 그 외의 종자 특성은 국내 재배품종의 자연적 변이 범위 내에 포함되었다. 또한, PPD 강화 GM벼의 현미에서는 지속적으로 PPD가 검출되었지만, 동진벼에서는 검출되지 않았다. 위의 연구 결과는 PPD 강화 GM벼가 농업적 특성을 유지하고, 기능성 성분인 PPD의 축적을 유지하고 있음을 보여줌으로써 기능성 작물로서의 가능성을 시사한다. 향후 PPD 강화 GM벼의 실용화를 위해 다양한 재배 환경에서의 생육 특성 평가 및 식품 안전성 연구가 필요할 것이다.
본 연구는 농촌진흥청 연구개발사업(과제번호: PJ01369102, PJ016726)의 지원으로 수행되었습니다.
Fig. 1
Schematic diagram of T-DNA region of the plasmid for overexpressing the CYP716A47 and PgDDS genes.
kjbs-57-3-205-f1.jpg
Fig. 2
Photographs of dongjinbyeo (white sign) and PPD-enriched GM rice (yellow sign) before (A) and after 8 days of treatment with 0.5% glufosinate ammonium (B).
kjbs-57-3-205-f2.jpg
Fig. 3
(A) Immunostrip test to identify bar protein expressed in PPD-enriched GM rice. N/C, distilled water of negative control; DJ, dongjinbyeo; T5, T6, T7: PPD-enriched GM rice. (B) The PCR analysis for detection of insert gene in PPD-enriched GM rice. N/C, distilled water of negative control; DJ, dongjinbyeo; T5, T6, T7: PPD-enriched GM rice; CYP716A47: protopanaxadiol synthase gene; PgDDS: dammarenediol-Ⅱ synthase gene; bar: glufosinate ammonium resistant gene; SPS: internal control in rice.
kjbs-57-3-205-f3.jpg
Table 1
PCR primers used for amplification of T-DNA flanking regions.
Table 1
Primer Primer sequence (5'-3')
RB1 AAGCTTAGCTTGAGCTTGGATCAGATTGTC
RB2 TTGTCGTTTCCCGCCTTCAG
LB1 TTCAAGCACGGGAACTGGCATGAC
LB2 GTTTCTGGCAGCTGGACTTC
Table 2
Primers used for PCR analysis of backbone DNA detection.
Table 2
Probe Primer Primer sequence (5'-3') Product Size (bp)
Bar Forward TCAAATCTCGGTGACGGG 466
Reverse CGAGACAAGCACGGTCAA

PgDDS Forward ACACCTCTGCATAGAGCAGC 175
Reverse GCAACCAAACACGTTTCCGA

CYP716A47 Forward TGAAGGAAATGGTCCGGCTC 186
Reverse TGCGCAAATCTTGGAATGGG

SPS Forward AAGTGTTGCATTCCCCAAGC 91
Reverse ACATGACTGGTGACAGACCTTCA
Table 3
Major agronomic traits of the dongjin and PPD-enriched GM rice.
Table 3
Cultivar Days to heading Culm length
(cm)
Panicle length
(cm)
No. of tiller Grain weight
per plant (g)
Dongjin 108.0±7.0 a 85.3±3.7 a 20.2±0.9 b 9.6±0.8 ab 30.03±0.78 a
PPD-enriched GM rice 109.0±7.0 a 84.1±1.6 a 20.2±0.5 b 8.6±0.4 b 28.43±2.26 a
Anmiz 100.0±2.8 a 74.5±2.5 b 23.2±1.0 a 15.2±4.0 a 32.44±6.41 a
Nipponbarez 107.7±4.2 a 80.4±4.5 ab 20.5±0.2 b 15.5±4.7 a 28.41±3.27 a
Literature 46-111y 55.0-122.0y 15.7-29.6x 5.6-18.8x -

The data were collected over three consecutive years with three replicates in Jeonju.

Values are presented as means±standard deviation (SD).

Means followed by different letters within the same column are significantly different at p<0.05.

zAnmi and nipponbare; non-transgenic cultivar was cultivated in Jeonju during 2021 and 2022.

yDays to heading and culm length were referenced from Lee et al. (2020), which evaluated 276 Korean rice varieties, including 87 early-maturing, 96 mid-maturing and 114 mid-to-late-maturing varieties.

xPanicle length and number of tiller were reference was obtained from Kim et al. (2016), which included data on 243 Korean rice varieties.

Table 4
Grain characteristics of brown rice in dongjin and PPD-enriched GM rice.
Table 4
Cultivar Brown rice (mm) Length/width ratio 1000-grains weight (g)

Length Width
Dongjin 5.10±0.04 b 2.97±0.02 a 1.72±0.03 b 24.47±0.15 a
PPD-enriched GM rice 5.23±0.03 a 2.93±0.07 ab 1.79±0.03 a 24.00±0.45 a
Anmiz 5.04±0.00 b 2.87±0.03 b 1.76±0.02 ab 21.32±0.34 c
Nipponbarez 5.11±0.05 b 2.89±0.00 ab 1.78±0.02 ab 22.34±0.08 b
Literaturey 4.67-5.91 2.84-3.05 0.56-1.90 21.8-25.9

The data were collected over three consecutive years with three replicates in Jeonju.

Values are presented as means±standard deviation (SD).

Means followed by different letters within the same column are significantly different at p<0.05.

zAnmi and nipponbare; non-transgenic cultivar was cultivated in Jeonju during 2021 and 2022.

yGrain characteristics were referenced from Lee et al. (2012), which included data on four Korean rice cultivars.

Table 5
Protopanaxadiol content of PPD-enriched GM rice and Dongjin.
Table 5
Cultivar Protopanaxadiol content (µg/g DW)
Dongjin NDz b
GM rice (T5) 15.0±1.2 a
GM rice (T6) 17.5±1.6 a
GM rice (T7) 16.5±6.0 a

zND, not detected.

Values are presented as means±standard deviation (SD).

Means followed by different letters within the same column are significantly different at p<0.05.

  • 1. Baek SH, Shin WC, Ryu HS, Lee DW, Moon E, Seo CS, Hwang ES, Lee HY, Ahn MH, Jeon YJ, Lee SW, Kim WY, Souza RD, Kim HJ, Hong ST, Jeon JS. 2013. Creation of resveratrol-enriched rice for the treatment of metabolic syndrome and related diseases. PLoS One 8: e57930.
  • 2. Chen L, Li R, Chen F, Zhang H, Zhu Z, Xu S, Zhao Y. 2022. A possible mechanism to the antidepressant-like effects of 20 (S)-protopanaxadiol based on its target protein 14-3-3 ζ. J Ginseng Res 46: 666-674.
  • 3. Cho JI, Park SH, Lee GS, Kim SM, Lim SM, Kim YS, Park SC. 2020. Current status of GM crop development and commercialization. Korean Society of Breeding Science 52: 40-48.
  • 4. Deng J, Liu Y, Duan Z, Zhu C, Mi Y, Yang H. HuJ2017. Protopanaxadiol and protopanaxatriol-type saponins ameliorate glucose and lipid metabolism in type 2 diabetes mellitus in high-fat diet/streptozocin-induced mice. Front Pharmacol 8: 506
  • 5. Dhungana SK, Kim BR, Son JH, Kim HR, Shin DH. 2015. Comparative study of CaMsrB2 gene containing drought-tolerant transgenic rice (Oryza sativa L.) and non-transgenic counterpart. J Agron Crop Sci 201: 10-16.
  • 6. EFSA Panel on Genetically Modified Organisms (GMO)2010. Guidance on the environmental risk assessment of genetically modified plants. EFSA Journal 8: 1879
  • 7. EFSA Panel on GMO2015. Guidance on the agronomic and phenotypic characterisation of genetically modified plants. EFSA Journal 13: 4128
  • 8. FAO/WHO.1996. Biotechnology and food safety: Report of a joint FAO/WHO consultation.
  • 9. Gao JL, Lv GY, He BC, Zhang BQ, Zhang H, Wang N, Wang CZ, Du W, Yuan CS, He TC. 2013. Ginseng saponin metabolite 20 (S)-protopanaxadiol inhibits tumor growth by targeting multiple cancer signaling pathways. Oncol Rep 30: 292-298.
  • 10. Go EM, An JH, Nam KJ, Nam KH, Park KW, Back K, Kim CG. 2013. Phenotype comparison between herbicide tolerant transgenic rice and weedy rice. Weed & Turfgrass Science 2: 15-22.
  • 11. Ha SH, Liang YS, Jung HR, Ahn MJ, Suh SC, Kweon SJ, Kim DH, Kim YM, Kim JK. 2010. Application of two bicistronic systems involving 2A and IRES sequences to the biosynthesis of carotenoids in rice endosperm. Plant Biotechnol J 8: 928-938.
  • 12. Han JY, Baek SH, Jo HJ, Yun DW, Choi YE. 2019. Genetically modified rice produces ginsenoside aglycone (protopanaxadiol). Planta 250: 1103-1110.
  • 13. ISAAA.2019. Global status of commercialized biotech/GM crops in 2019: Biotech crops drive socio-economic development and sustainable environment in the new frontier. ISAAA Brief. No. 54. Ithaca, NY.
  • 14. Jeong JM, Jeung JU, Kang KH, Lee SB, Park HM, Kim CK, Kim KM, Sohn JK. 2013. Evaluations on agronomic traits of rice transgenic lines. Korean J Crop Sci 58: 196-202.
  • 15. Kang YS. 2019. Safety evaluation and approval status of genetically modified foods in Korea. Food Sci Ind 52: 130-139.
  • 16. Kantayos V, Shin WC, Kim JS, Jeon SH, Rha ES, Baek SH. 2021. Resveratrol-enriched rice identical to original Dongjin rice variety with respect to major agronomic traits in different cultivation years and regions. GM Crops & Food 12: 449-458.
  • 17. Kim HR, Lee CH, Jung MY, Kim JS, Kim HJ, Jeon HS, Lee SH, Kim JH, Shin MJ, Ma SY, Kwon J, Oh CH. 2019. Anti-obesity effects of cultivated ginseng, -wild simulated ginseng and-red ginseng extracts. Herb Formula Sci 27: 269-284.
  • 18. Kim MS, Lee HJ, Yu DA, Song JY, Nino M, Nogoy F, Cho YG. 2016. Classification of Korean rice varieties based on agro-morphological traits. Korean J Breed Sci 48: 254-270.
  • 19. Kim NY, Oh SD, Park SY, Chang AC, Lee SK, Jang YJ, Yun DW. 2024. Comparative nutritional analysis for protopanaxadiol-enhanced genetically modified rice and its non-transgenic counterpart. Korean J Agric Sci 51: 239-249.
  • 20. Lee CM, Kwon YH, Park HM, Jeung JU, Park HS, Baek MK, Mo YJ. 2020. Days to heading and culm length variation of Korean rice varieties in different environments. Korean Society of Breeding Science 52: 389-397.
  • 21. Lee HS, Yi GH, Kim KM. 2012. Comparison of the genetic safety of transgenic rice in a large-scale field study. J Life Sci 22: 1173-1179.
  • 22. Lee SY, Kim EG, Park JR, Jang YH, Jan R, Ryu TH, Kim KM. 2021. Construction of risk assessment manual for genetically modified rice (Oryza sativa L.). J Crop Sci Biotechnol 24: 221-228.
  • 23. Lee Y, Kantayos V, Kim JS, Rha ES, Son YJ, Baek SH. 2022. Inhibitory effects of protopanaxadiol-producing transgenic rice seed extracts on RANKL-induced osteoclast differentiation. Life (Basel) 12: 1886
  • 24. Ministry of Food.Drug Safety (MFDS).2024. Current status of safety assessment and approval of genetically modified foods. https://www.foodsafetykorea.go.kr/portal/board/board.do?menu_grp=MENU_NEW01&menu_no=2812.
  • 25. Monmai C, Kim JS, Promyot K, Baek SH. 2023a. Protopanaxadiol-enriched rice extracts suppressed oxidative and melanogenic activities in melan-a cells. Antioxidants 12: 166
  • 26. Monmai C, Kim JS, Sim HB, Yun DW, Oh SD, Rha ES, Kim JJ, Baek SH. 2023b. Protopanaxadiol-enriched rice exerted antiadipogenic activity during 3T3-L1 differentiation and anti-inflammatory activity in 3T3-L1 adipocytes. Pharmaceutics 15: 2123
  • 27. OECD.1993. Safety considerations for biotechnology: Scale up of crop plants. Organisation for Economic Co-operation and Development. pp. 1-43..
  • 28. Park SH, Cho JI, Kim YS, Kim SM, Lim SM, Lee GS, Park SC. 2018. National program for developing biotech crops in Korea. Plant Breed Biotechnol 6: 171-176.
  • 29. Qaim M. 2009. The economics of genetically modified crops. Annu Rev Resour Econ 1: 665-694.
  • 30. Rural Development Administration (RDA).2012. Standard of analysis and survey for agricultural research. RDA, Jeonju, Korea. pp. 315-338..
  • 31. Shibata S, Tanaka O, Soma K, Iida Y, Ando T, Nakamura S. 1965. Studies on saponins and sapogenin of ginseng, the structure of panaxatriol. Tetrahedron Lett 6: 207-213.
  • 32. Shibata S. 2001. Chemistry and cancer preventing activities of ginseng saponins and some related triterpenoid compounds. J Korean Med Sci 16(Suppl):S28
  • 33. Song J, Tang L, Cui Y, Fan H, Zhen X, Wang J. 2024. Research progress on photoperiod gene regulation of heading date in rice. Curr Issues Mol Biol 46: 10299-10311.
  • 34. Szakiel A, Pączkowski C, Henry M. 2011. Influence of environmental abiotic factors on the content of saponins in plants. Phytochem Rev 10: 471-491.
  • 35. Tansakul P, Shibuya M, Kushiro T, Ebizuka Y. 2006. Dammarenediol-II synthase, the first dedicated enzyme for ginsenoside biosynthesis, in Panax ginseng. FEBS Lett 580: 5143-5149.
  • 36. Wei H, Wang X, Xu H, Wang L. 2020. Molecular basis of heading date control in rice. Abiotech 1: 219-232.
  • 37. Yun TK. 2001. Brief introduction of Panax ginseng C.A. Meyer. J Korean Med Sci 16(Suppl):S3-5.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Comparative Evaluation of Major Agronomic Traits of Protopanaxadiol-enriched GM Rice
Korean. J. Breed. Sci.. 2025;57(3):205-215.   Published online September 1, 2025
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Comparative Evaluation of Major Agronomic Traits of Protopanaxadiol-enriched GM Rice
Korean. J. Breed. Sci.. 2025;57(3):205-215.   Published online September 1, 2025
Close

Figure

  • 0
  • 1
  • 2
Comparative Evaluation of Major Agronomic Traits of Protopanaxadiol-enriched GM Rice
Image Image Image
Fig. 1 Schematic diagram of T-DNA region of the plasmid for overexpressing the CYP716A47 and PgDDS genes.
Fig. 2 Photographs of dongjinbyeo (white sign) and PPD-enriched GM rice (yellow sign) before (A) and after 8 days of treatment with 0.5% glufosinate ammonium (B).
Fig. 3 (A) Immunostrip test to identify bar protein expressed in PPD-enriched GM rice. N/C, distilled water of negative control; DJ, dongjinbyeo; T5, T6, T7: PPD-enriched GM rice. (B) The PCR analysis for detection of insert gene in PPD-enriched GM rice. N/C, distilled water of negative control; DJ, dongjinbyeo; T5, T6, T7: PPD-enriched GM rice; CYP716A47: protopanaxadiol synthase gene; PgDDS: dammarenediol-Ⅱ synthase gene; bar: glufosinate ammonium resistant gene; SPS: internal control in rice.
Comparative Evaluation of Major Agronomic Traits of Protopanaxadiol-enriched GM Rice

PCR primers used for amplification of T-DNA flanking regions.

Primer Primer sequence (5'-3')
RB1 AAGCTTAGCTTGAGCTTGGATCAGATTGTC
RB2 TTGTCGTTTCCCGCCTTCAG
LB1 TTCAAGCACGGGAACTGGCATGAC
LB2 GTTTCTGGCAGCTGGACTTC

Primers used for PCR analysis of backbone DNA detection.

Probe Primer Primer sequence (5'-3') Product Size (bp)
Bar Forward TCAAATCTCGGTGACGGG 466
Reverse CGAGACAAGCACGGTCAA

PgDDS Forward ACACCTCTGCATAGAGCAGC 175
Reverse GCAACCAAACACGTTTCCGA

CYP716A47 Forward TGAAGGAAATGGTCCGGCTC 186
Reverse TGCGCAAATCTTGGAATGGG

SPS Forward AAGTGTTGCATTCCCCAAGC 91
Reverse ACATGACTGGTGACAGACCTTCA

Major agronomic traits of the dongjin and PPD-enriched GM rice.

Cultivar Days to heading Culm length
(cm)
Panicle length
(cm)
No. of tiller Grain weight
per plant (g)
Dongjin 108.0±7.0 a 85.3±3.7 a 20.2±0.9 b 9.6±0.8 ab 30.03±0.78 a
PPD-enriched GM rice 109.0±7.0 a 84.1±1.6 a 20.2±0.5 b 8.6±0.4 b 28.43±2.26 a
Anmiz 100.0±2.8 a 74.5±2.5 b 23.2±1.0 a 15.2±4.0 a 32.44±6.41 a
Nipponbarez 107.7±4.2 a 80.4±4.5 ab 20.5±0.2 b 15.5±4.7 a 28.41±3.27 a
Literature 46-111y 55.0-122.0y 15.7-29.6x 5.6-18.8x -

Grain characteristics of brown rice in dongjin and PPD-enriched GM rice.

Cultivar Brown rice (mm) Length/width ratio 1000-grains weight (g)

Length Width
Dongjin 5.10±0.04 b 2.97±0.02 a 1.72±0.03 b 24.47±0.15 a
PPD-enriched GM rice 5.23±0.03 a 2.93±0.07 ab 1.79±0.03 a 24.00±0.45 a
Anmiz 5.04±0.00 b 2.87±0.03 b 1.76±0.02 ab 21.32±0.34 c
Nipponbarez 5.11±0.05 b 2.89±0.00 ab 1.78±0.02 ab 22.34±0.08 b
Literaturey 4.67-5.91 2.84-3.05 0.56-1.90 21.8-25.9

Protopanaxadiol content of PPD-enriched GM rice and Dongjin.

Cultivar Protopanaxadiol content (µg/g DW)
Dongjin NDz b
GM rice (T5) 15.0±1.2 a
GM rice (T6) 17.5±1.6 a
GM rice (T7) 16.5±6.0 a
Table 1 PCR primers used for amplification of T-DNA flanking regions.
Table 2 Primers used for PCR analysis of backbone DNA detection.
Table 3 Major agronomic traits of the dongjin and PPD-enriched GM rice.

The data were collected over three consecutive years with three replicates in Jeonju.

Values are presented as means±standard deviation (SD).

Means followed by different letters within the same column are significantly different at p<0.05.

zAnmi and nipponbare; non-transgenic cultivar was cultivated in Jeonju during 2021 and 2022.

yDays to heading and culm length were referenced from Lee et al. (2020), which evaluated 276 Korean rice varieties, including 87 early-maturing, 96 mid-maturing and 114 mid-to-late-maturing varieties.

xPanicle length and number of tiller were reference was obtained from Kim et al. (2016), which included data on 243 Korean rice varieties.

Table 4 Grain characteristics of brown rice in dongjin and PPD-enriched GM rice.

The data were collected over three consecutive years with three replicates in Jeonju.

Values are presented as means±standard deviation (SD).

Means followed by different letters within the same column are significantly different at p<0.05.

zAnmi and nipponbare; non-transgenic cultivar was cultivated in Jeonju during 2021 and 2022.

yGrain characteristics were referenced from Lee et al. (2012), which included data on four Korean rice cultivars.

Table 5 Protopanaxadiol content of PPD-enriched GM rice and Dongjin.

zND, not detected.

Values are presented as means±standard deviation (SD).

Means followed by different letters within the same column are significantly different at p<0.05.