Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

고추약한모틀바이러스 병원형 P 및 P 생물검정을 통한 저항성 고추유전자원 선발

허온숙1,*, 곽해련2, 노나영1, 최유미1, 이수경1, 황애진1, 김빛샘1, 김성훈1, 한범수1

Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3

Korean Journal of Breeding Science 2022;54(1):1-7.
Published online: March 1, 2022

1농촌진흥청 국립농업과학원 농업유전자원센터

2농촌진흥청 국립농업과학원 농산물안정성부 작물보호과

1National Agrobiodiversity Center, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Republic of Korea

2Crop Protection Division, Dept. of Agro-Food Safety and Crop Protection, National Institute of Agricultural Sciences, RDA, Wanju 55365, Republic of Korea

*Corresponding Author (E-mail: oshur09@korea.kr, Tel: +82-63-238-4942, Fax: +82-63-238-4859)
• Received: October 19, 2021   • Revised: November 17, 2021   • Accepted: November 29, 2021

Copyright © 2022 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 163 Views
  • 1 Download
  • 1 Crossref
next
  • Pepper mild mottle virus (PMMoV), a member of the genus Tobamovirus, is one of the most threatening pathogens affecting commercial pepper production, and it is classified into pathotypes P1,2 and P1,2,3. As chemical and physical treatments show limited success in controlling PMMoV, resistant pepper varieties are considered the most effective means of disease control. Two hundred pepper germplasms, including 167 accessions of Capsicum chinense and 5 reference accessions known as resistant L alleles, were assessed using a bioassay to select germplasms resistant to PMMoV. Six accessions, including IT261210, were resistant to both PMMoV pathotypes P1,2 and P1,2,3 as they developed necrotic local lesions only on inoculated leaves, whereas no symptoms were observed on the upper leaves. Moreover, RT-PCR results of the upper leaves of these accessions were also negative. Thus, the identified accessions may be a novel source of genetic resistance against present or emerging new pathotypes and may be useful for differentiating L alleles.
Tobamovirus 속 바이러스에 속하는 고추약한모틀바이러스(Pepper mild mottle virus, PMMoV)는 1984년 이탈리아에서 최초로 보고되었으며(Wetter et al. 1984), 이후 전 세계 고추(Capsicum spp.) 재배지로 퍼져 수량과 품질을 크게 떨어뜨려 경제적 손실을 입히고 있다(Genda et al. 2005). 우리나라 고추 재배지에 발생하는 바이러스 병으로 Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), Pepper mild mottle virus (PMMoV), Broad bean wilt virus 2 (BBWV2), Tobacco mild green mosaic virus (TMGMV) 및 Tomato spot wilt virus (TSWV) 등이 확인되었으며, 이 중 PMMoV가 단독 감염률이 세 번째로 높은 바이러스로 알려져 있다(Choi et al. 2005). 감염된 토양이나 종자(Wetter & Conti 1988) 또는 감염된 식물체로부터 작업자의 물리적인 접촉 전염으로 빠르게 퍼질 수 있으며(Choi et al. 2011), 오랜 기간 동안 토양 내에서 새로운 감염원이 될 수 있다(Ikegashira et al. 2004). PMMoV를 가장 효과적으로 방제하려면 저항성 품종을 심어 회피하는 것이다(Lamb et al. 2001). 하지만 저항성 고추 품종을 개발해도 고추의 저항성을 깨는 바이러스의 새로운 균주가 나타나므로 저항성 자원의 발굴은 지속적으로 필요하다(Betti et al. 1986).
Flor (1971)는 병원균과 식물체 간 저항성을 보이는 상호작용을 “gene for gene” 개념으로 설명하였다. 바이러스 유전자와 식물 유전자 사이의 인식으로 바이러스가 식물체에 감염 성공 여부를 가르며, 감염된 식물 세포 내에 존재하는 바이러스의 외피 단백질이 기주 식물의 방어작용을 일으키는 신호가 된다(Culver et al. 1989a, Culver et al. 1989b). 고추에서 분리된 Tobamovirus 속 바이러스 균주들은 4그룹(pathotypes; TMV, ToMV, PMMoV-P1,2, P1,2,3)으로 분류되며, 이는 11번 염색체 상에 위치한 고추의 L 대립유전자 상의 서로 다른 4개의 저항성 유전자 L1, L2, L3, L4와의 상호작용에 따라 결정된다(Boukema 1977, Boukema et al. 1980, Tomita et al. 2011). Tobamovirus 속 바이러스에 대한 고추의 저항성은 멘델법칙에 의하여 유전되며 L 유전자좌 내의 대립유전자간 변이에 따라 정해진다(Grube et al. 2000, Sawada et al. 2004). 국내 고추 재배지에서 주로 발견되는 PMMoV는 P1,2L1, L2 유전자를 가진 식물체를 감염시키고 L3, L4 유전자를 가진 식물체에서는 HR 반응으로 병이 더 이상 진전되지 않는다. 국내 파프리카 과실에서 L3 유전형을 보유한 저항성을 깨는 P1,2,3 균주가 확인되었고(Choi et al. 2013), 2004년 일본에서 Miogi 품종(L4/L+)에 약한 모자이크 반응을 내는 균주를 분리하였고(Genda et al. 2007), 이스라엘에서도 2008년 L4 유전자를 가진 저항성 고추 품종을 감염시키는 P1,2,3,4를 보고한 바가 있다(Antignus et al. 2008). 현재 국내 시판 품종에는 대부분 L2 저항성 유전자가 들어있는데, L3, L4 유전자를 가진 자원을 찾아 저항성 품종을 개발하는 일이 시급하다.
고추의 저항성 유전자를 신속하게 확인하기 위해 분자표지의 개발도 꾸준히 이루어졌다. L4 저항성 유전자와 1.5 cM 정도 떨어져 있는 WA31-1500-SCAR (sequence characterized amplified region) 분자표지(Matsunaga et al. 2003), L3 유전자와 4.0 cM 떨어져 있는 PMFR11-SCAR 분자표지(Sugita et al. 2004), L4 유전자와 0.9-1.8 cM 정도 떨어져 있는 L4SC340-SCAR 분자표지(Kim et al. 2008)와 L4 유전자와 1.5 cM 떨어져 있는 087H03T7- SNP (single nucleotide polymorphism) 분자표지(Yang et al. 2009)가 보고되었다. L 대립유전자 특이적 SNP (HRM, high resolution melting analysis) 분자표지 L4RP-3F/L4RP-3R를 개발(Yang et al. 2011)하였으나 고정된 계통에서 L 유전자의 구분은 용이하지만, 이형접합체(heterozygote) 개체의 L 대립유전자 구분은 쉽지 않다(Lee et al. 2012). Lee et al. (2012)L 유전자좌의 대립유전자를 구분할 수 있는 L4-SCAR, L3-SCAR, L2-CAPS, L1-SCAR, L0c-SCAR 및 L0nu-CAPS 분자표지를 개발하여, 53개의 시판 품종 중 48개에서 분자표지에 의한 추정 유전자형과 바이러스 P1, P1,2 균주의 접종 표현형이 일치함을 확인하였다. 하지만 일부 자원에서 표현형과 분자표지 간에 재조합을 확인하였고(Lee et al. 2012), L 유전자좌의 저항성 대립유전자(L1, L2, L3, 및 L4)가 같은 유전자인지 서로 다른 유전자인지 불확실하지 않으므로(Yang et al. 2011) 유전형 분석에 사용할 수 있는 표현형 정보가 확실한 자원의 발굴도 지속적으로 이루어져야 한다.
따라서 본 연구는 고추유전자원 200자원을 대상으로 PMMoV- P1,2 및 P1,2,3균주에 대해 생물검정을 실시하고 저항성 유전자 보유 자원을 선발하여 유전형 분석 재료와 품종 개발을 위한 소재로 활용하고자 수행되었다.
식물재료
농촌진흥청 농업유전자원센터에서 보유하고 있는 고추 유전자원 중 L3 유전자가 발견된 유전자원과 같은 종인 C. chinense 167자원과 나머지 재배종 33자원, 총 200자원을 대상으로 하였다. 병원형 별 균주 접종 후 생물반응을 확인하기 위하여 L 유전자형이 L0, L1, L2, L3, L4로 이미 알려진 다섯 개의 고추 유전자원을 사용하였다(Table 1). 식물체는 유전자원센터 유리온실에서 재배하였으며, 각 자원당 4개체씩 파종하여 3개체는 접종하고 나머지 한 개체는 무접종구로 사용하였다. 병원형 P1,2에 대한 저항성 평가를 두 번에 걸쳐 반복 실험하였고, 저항성 자원에 대해서만 병원형 P1,2,3에 대한 저항성 평가를 추가로 실시하였다.
바이러스원 및 유지
고추약한모틀바이러스 접종 평가를 위하여 바이러스 접종원은 고추에서 분리한 PMMoV-NS-RP13 (pathotype: P1,2; Accession no. MT629888), 파프리카에서 분리한 PMMoV-KP3 (pathotype: P1,2,3; Accession no. LC082100)를 담배(Nicotiana occidentalis)에서 증식한 접종원을 국립농업과학원 작물보호과에서 제공받아 사용하였다.
바이러스 접종 및 저항성 평가
식물체의 본엽이 3~4엽으로 완전 전개하였을 때 1~2엽에 PMMoV 표준균주를 감염시킨 담배(N. occidentalis) 잎 1 g에 인산완충액(0.01 M Sodium phosphate buffer, pH 7.0)을 10 mL (1:10 w/v)을 넣어 마쇄한 후 즙액접종(sap transmission)을 실시하였다. 먼저 접종엽에 Carborundum (600 mesh, Fisher Sceintific, USA)을 뿌리고 접종원을 문질러 줌으로써 기계적 상처 접종(mechanical transmission)을 수행하였다. 접종이 완료된 후 바로 Carborundum을 씻어내고 온실에서 주간 온도 28℃ 이하로 관리하여 접종 후 1주일 간격으로 6주간 병징을 확인하였다. 접종엽에 괴사 반점이 생기고 상위엽에 증상이 보이지 않으며 저항성으로, 상위엽에 모자이크, 모틀, 위축 등의 증상이 보이면 감수성으로 평가하였다.
Total RNA 분리
Plant RNA Prep Kit (Biocubesystem, Korea)를 사용하여 매뉴얼에 따라 수집한 total RNA를 분리하였다. 동결된 시료 0.1 g을 1.5 mL 튜브에 옮기고 extraction buffer 450 μL와 2-mercaptoethanol 4.5 μL를 넣고 잘 섞어 준 후 상층액 450 μL를 filter column에 옮기고 냉장원심분리기(LABOGENE, Korea)에서 4℃, 13,000 rpm에서 3분간 원심분리를 수행하였다. 여과액 400 μL를 2.0 mL 튜브에 분주하고 에탄올 200 μL를 첨가한 후 잘 섞어 준 후 RNA Spin 컬럼을 2.0 mL 튜브에 장착하고 혼합액 400 μL를 컬럼에 옮긴 다음 13,000 rpm에서 1분간 원심분리를 수행하였다. Washing buffer 1을 700 μL씩 RNA Spin 컬럼에 분주하고, 13,000 rpm에서 1분간 원심분리 후 여액을 버린 다음 컬럼을 재장착하였다. Washing buffer 2를 500 μL씩 RNA Spin 컬럼에 분주하고, 13,000 rpm에서 1분간 원심분리 후 여액을 버린 다음 컬럼을 재장착하였다. 여액을 버리고 컬럼을 새 튜브에 장착 한 후 뚜껑을 열고 2분간 건조시켰다. RNase-free water 50 μL를 컬럼에 첨가한 다음 실온에서 3분간 정치하고 13,000 rpm에서 2분간 원심분리하여 RNA를 회수하였다.
RT-PCR
역전사 반응은 SuPrimeScript RT-PCR Premix (2×) (SR-8002, GeNetBio, Korea)를 이용하여 수행하였다. 추출한 total RNA 1.0 μL를 주형으로 사용하고 PMMoV 특이 프라이머(Table 2)를 이용하여 forward primer와 reverse primer를 각각 0.5 μL씩, 2×RT-PCR premix를 10 μL를 첨가한 후 멸균수로 전체 용량을 20 μL로 조정하였다. 역전사 반응은 T100 thermal cycler (BioRad, Korea) 모델을 이용하여, 55℃에서 30분간 항온처리 후 95℃에서 10분간 초기변성(denaturation) 후, 95℃에서 30초 동안 변성(denaturation), 55℃에서 30초 동안 가열냉각(annealing), 72℃에서 1분동안 길이확장(extension) 과정을 35회 반복하였다. 마지막으로 72℃에서 5분간 완전한 길이확장(full extension) 반응을 수행하였다. RT-PCR 산물은 1×TAE buffer를 이용하여 1.2% agarose gel에서 전기영동 한 후 ethidium bromide로 염색하여 자외선 투과기(UV trasilluminator)로 확인하였다.
고추약한모틀바이러스에 저항성을 가진 고추 유전자원을 선발하기 위하여, 고추 유전자원 200자원에 대하여 국내 고추에서 분리한 PMMoV-NS-RP13 (pathotype: P1,2)을 본엽 3~4엽 완전 전개기에 1~2 엽에 접종하여 25±3℃ 환경 조절 유리온실에서 생물반응을 조사하였다. 먼저 유전형이 알려진 5개의 고추 유전자원에 병원형 P1,2인 PMMoV-NS-RP13를 접종하여 발병 증상을 확인하였다. ECW (L0), Tisana (L1), CM33 4(L2) 자원의 접종엽에서는 증상이 나타나지 않았고 상엽에 약한모틀과 모자이크 증상을 보여 바이러스가 상위엽으로 이행하는 것을 확인하였다. PI 159236 (L3), PI 260429 (L4)에서는 접종엽에 괴사 반점이 나타났고 상엽에는 이병증상을 보이지 않았다(Table 1). 또한 상엽을 RT-PCR 진단한 결과, 감염 증상을 보인 ECW, Tisana 및 CM334에서 PMMoV 특이 밴드가 증폭이 되었고, PI159236, PI260429 자원에서는 밴드가 확인되지 않았다(Fig. 1). 이는 기존에 알려진, Tobamovirus의 병원형(P0, P1, P1,2, 및 P1,2,3)과 Tobamovirus에 대한 고추의 저항성 L 대립유전자(L1, L2, L3, 및 L4)의 계층적 상호작용(Boukema 1980, Tomita et al. 2011)과 동일하였다. 다음은 PMMoV-NS-RP13 (pathotype: P1,2)로 고추 유전자원 200자원에 대하여 생물검정을 실시하였다. 대상자원은 병원형 P1,2에 저항성 유전형 L3가 발견된 PI159236과 같은 종인 C. chinense 167자원과 국내 주요 재배형인 C. annuum 25자원, 그리고 기타 재배형인 C. baccatum 4자원, C. frutescens 3자원, C. galapagoense 1자원으로 하였다. 200자원의 병원형 P1,2 접종 후 발병율 분포를 살펴보면, 발병율 0%로 상위엽으로 이병되지 않은 자원은 IT261211을 포함하여 7자원이며 모두 C. chinense에 속하였다. 발병율이 0%초과 20%이하인 자원은 IT158578을 포함하여 8자원으로 이 중 C. chinense가 7자원, C. baccatum이 1자원이었다. 발병율 40%초과 60%이하인 자원은 IT158609을 포함하여 18자원으로 C. chinense가 12자원, C. annuum이 5자원, C. baccatum이 1자원이었다. 발병율 60% 초과 80%이하에 속하는 IT219987을 포함하여 13자원으로 이들의 종 분포는 C. chinense가 9자원, C. annuum이 4자원이었으며, 80%초과 100%이하인 자원은 IT182545을 포함하여 143자원으로 이중 125자원이 C. chinense이며, C. annuum, C. baccatumC. frutescens가 각각 14자원, 2자원, 2자원이었다(Fig. 2, Supplementary Table 1). 고추 유전자원의 병원형 P1,2에 대한 생물반응은 Choi et al. (2014)은 파프리카 품종의 저항성 스크리닝 결과 및 대조 유전자원의 반응과 동일한 양상을 보인다고 보고하였다. 저항성 자원은 접종엽에서만 괴사 반점이 나타났고 상엽에는 감염되지 않았다. 이병 개체들은 접종엽에는 증상이 나타나지 않거나, 엽맥을 따라 괴사가 발현되었고 줄기 괴사 증상이나 상엽에 약한 모틀 또는 모자이크 증상을 보였다(Table 3).
PMMoV-P1,2 생물검정 및 PCR 진단을 통해 저항성을 보이는 자원을 대상으로 PMMoV-P1,2,3 균주를 접종하여 생물검정을 실시하였다. 평가된 6개의 고추 유전자원 IT261210, IT261211, IT261426, IT261431, IT261442 및 IT284050는 모든 개체에서 접종한 잎에 단지 국부 병반을 형성하였고 상엽으로 이행되지 않았다. 또한 PCR진단 결과에서 음성으로 나타낸 것으로 보아, 병원형 P1,2 및 P1,2,3균주 모두에서 저항성을 보였음으로 저항성 유전형 L4를 갖고 있을 것으로 예측해 볼 수 있다(Table 4). Choi et al. (2014)에 따르면, L4 유전형을 동형접합체로 가지고 있는 Magnipico 및 Easy 품종과 이형접합체로 가지고 있는 Scirocco, Orange glory 및 Special 품종은 병원형 P1,2 및 병원형 P1,2,3에 대한 생물반응으로 접종엽에 괴사 반점이 나타났으나 상위엽으로는 병징이 올라가지 않았다. 하지만 L3 유전형을 동형접합체로 가지고 있는 Fiesta, Piero 및 Derby 품종의 경우 저항성을 보여야 하는 병원형 P1,2을 접종했을 때 접종엽에 엽맥 괴사나 식물체 상단부위에 괴사가 발생하였으며, 이는 식물체 저항성이 과민하게 나타나는 것으로 볼 수 있다(Heath 2000)고 해석하였다. 본 실험에서도 초기 3~4엽이 완전전개하지 않은 이른 시기인 1~2엽에 접종했을 때 IT26144를 포함한 일부 개체가 줄기 괴저를 시작으로 식물체 전체 괴사 반응을 보였고(Fig. 3C, 데이터 미제시), 이후 접종 시기를 완전전개기인 3~4엽기 늦추었을 때 저항성과 감수성을 구분할 수 있었다. Antigus et al. (2008)은 P1,2균주를 L3, L4 유전자 이형접합체인 고추에 접종한 결과, 접종엽의 괴사반응과 상위엽으로의 전이가 동시에 나타나 저항성이 깨지는 반면 L3, L4 유전자 동형접합체인 고추에서는 접종엽에만 국부 반응을 보여 저항성인 결과를 보였다. 이는 저항성 유전자의 “dosage effect”로 유전형이 이형접합체인 식물체에서의 저항성은 완전우성 형태로 유전되지 못해 저항성 수준이 낮아진 것이다(Boukema 1980). 고추의 L 유전자좌 연관 대립유전자 특이분자표지 개발 연구에서도, 시판 고추 품종 53개를 대상으로 병원형 P1,2균주를 접종하고 생물검정 결과 저항성을 갖는 자원들이 90%이상 유전형 L3 또는 L4를 가지고 있었다(Lee et al. 2012). 표현형과 추정 유전자형이 다른 자원에 대해서는 계통 육성 중 유전자 재조합으로 실제 L 유전자는 소실되었으나 연관 분자표지 염기서열은 남아있는 것으로 분석하였다(Lee et al. 2012). 따라서 유전자와 더 가까운 분자표지의 개발을 위해서 표현형 정보가 확인된 다양한 자원의 선발이 필요하다.
2004년 이후 일본과 이스라엘에서 고추의 L4 저항성을 깨는 PMMoV-P1,2,3,4균주가 보고되었으며, 이는 기존의 균주와 외피 단백질(Coat protein) 아미노산 배열의 차이를 보였다. 이스라엘 균주 PMMoV-Is는 병원형 P1,2인 균주와 비교하여 47번 위치에서 류신이 글루타민으로, 87번 위치에서 알라닌이 글라이신으로 바뀌어 있었고, P1,2,3 병원형 균주와 비교하면 87번 위치만 알라닌에서 글라이신으로 바뀌어 있었다(Antignus et al. 2008). 이는 외피 단백질 내에서 하나 또는 소수의 아미노산의 변화로 식물체가 균주를 인식하지 못해 기주 식물이 저항성을 보이다가 바이러스가 식물체내로 전이되는 기존의 결과들(Alonso et al. 1991, Garcia-Luque et al. 1993)과 일치하였다. 한편 일본에서 발견된 P1,2,3,4균주는 P1,2균주에서 46번 위치에서 글라이신이 아르기닌으로, 85번 위치에서 글라이신이 라이신으로 바뀐 것을 확인하였으나, P1,2,3균주와 차이가 없어 P1,2,3,4가 고추 속을 감염시키는 어떤 병원형에서도 랜덤으로 변이될 수 있는 가능성이 있지 않을까라고 고찰하였다(Genda et al. 2007).
본 연구에서 선발한 고추 유전자원은 PMMoV-P1,2 및 P1,2,3균주에 대해서 저항성을 갖고 있으며, C. chinense 종인 IT261426과 IT261431은 미숙과색이 녹색, 성숙과색은 짙은 갈색으로 좁은 삼각형 형태를 보였으며 과실 길이는 각각 11.5±0.8 cm, 9.7± 0.7 cm이다. IT261442는 길이 2.1±0.2 cm이하의 원형과에 숙과는 적색이였다. IT284050은 타바스코 형태로 미숙과는 밝은 노랑색에서 익으면 오렌지빛깔을 띄었으며, 과실의 길이는 3.6±0.3 cm 이였다(Fig. 4). 이들은 저항성 유전자 L4를 보유하고 있을 것으로 기대되며, 고추약한모틀바이러스 저항성 육성 및 유전형 분석재료로 활용될 수 있을 것으로 생각된다. 특히 식물체의 저항성을 무너뜨리는 병원균의 진화속도가 빠르고 저항성 유전자의 dosage effect도 있으므로 저항성 유전자원의 발굴과 유전형 분석은 고추 품종 육성에 중요한 의미를 갖는다고 할 수 있다.
고추약한모틀바이러스(Pepper mild mottle virus, PMMoV)는 Tobamovirus 속에 속하며, 병원형 P1,2와 P1,2,3의 두 그룹으로 분류된다. PMMoV의 방제로는 화학적, 물리적 방법이 효과가 적어, 저항성 품종을 재배하는 것이 가장 효율적인 방법으로 알려져 있다. 고추약한모틀바이러스에 대한 저항성 유전자원을 선발하고자, C. chinense 167자원을 포함한 고추 유전자원 200자원 및 유전형이 L0, L1, L2, L3, L4로 알려진 5자원의 대조품종에 대하여 생물검정을 실시하였다. 먼저 PMMoV 병원형 P1,2에 대하여 생물검정을 실시하고 저항성을 확실히 하고자 PCR진단을 수행하였다. 이후 PMMoV-P1,2 저항성자원들에 대해 병원형 P1,2,3균주로 생물검정을 추가로 실시하였다. IT261210을 포함한 6자원이 병원형 P1,2 및 P1,2,3균주에 대한 생물검정 결과, 접종엽에 괴사 반응을 보였으며 상위엽으로 병징이 이행되지 않았으며 RT-PCR진단에서도 음성이 나와 저항성으로 판별되었다. 이 자원들은 저항성 품종 육성 및 유전형 분석 연구재료로 활용될 것으로 기대된다.
본문의 Supplementary Table 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.
본 논문은 농촌진흥청 연구사업(과제번호: PJ01424002)의 지원에 의해 이루어졌습니다.
Fig. 1
Reverse transcription polymerase chain reaction (RT-PCR) for PMMoV in reference pepper germplasm. First lane, size marker; L0, Early California Wonder (Capsicum annuum); L1, Tisana (C. annuum); L2, CM334 (C. annuum); L3, PI159236 (C. chinense); L4, PI260429 (C. chacoense); P, positive control Inoculum N. occidentalis; N, negative control DW.
kjbs-54-1-1-f1.jpg
Fig. 2
Frequency distribution of disease incidence of 200 C. chinense to PMMoV-P1,2. Disease incidence (%)=No. of plant infected / No. of plant inoculated *100.
kjbs-54-1-1-f2.jpg
Fig. 3
Various symptoms of pepper plants with PMMoV pathotype P1,2. (A) Mosaic on the upper leaf, (B) Mottle on the upper leaf, (C) Whole necrosis, (D) Necrotic lesion in the inoculated leaf.
kjbs-54-1-1-f3.jpg
Fig. 4
Morphological characteristics of four C. chinense accessions resistant to PMMoV-P1,2,3. (A) IT261426, (B) IT261442, (C) IT284050, (D) IT261431.
kjbs-54-1-1-f4.jpg
Table 1
Reference plant materials used in this study
Table 1
IT no. Acc. name Species Genotype Reference Biological reaction P1,2z
IT158331 Early Califonia Wonder (ECW) C. annuum L0/L0 Boukema 1980 -/m, mo
IT158337 Tisana C. annuum L1/L1 Han et al. 2001 -/m, mo
IT250209 CM334 C. annuum L2/L2 Lee et al. 2012 -/m, mo
IT236726 PI159236 C. chinense L3/L3 Boukema 1980 nl/-
IT158713 PI260429 C. chacoense L4/L4 Boukema 1984 nl/-

znl: necrotic lesion, m: mosaic, mo: mottle

Table 2
Primer set used for confirmation of the PMMoV existence in samples
Table 2
Primer name Sequence (5'-3') Loci Size (bp) Gene
PMMoV-5F AGGTTAGAATTGGGCAGAAC 5627-5646 684 CP (5685-6158)
PMMoV-5R ATTACGTCGTTCGCAAATAC 6310 -6291
Table 3
Reactions of different Capsicum genotypes to infection with pepper mild mottle virus P1,2
Table 3
IT no.. Acc. name Origin Resistance to PMMoV_NS-RP13
Symptomz Incidencey RT-PCR Response
IT261209 PI315014 PER nl/nl,- 3/3 - R
IT261210 PI315012 PER nl/- 3/3 - R
IT261211 PI315017 PER nl/- 3/3 - R
IT261221 Peru-5363 CRI nl/- 3/3 + R
IT261414 BISBAS YEM -/mo 3/3 +++ S
IT261426 VC112a UNK nl/- 3/3 - R
IT261431 TC 07589 ECU nl/- 3/3 - R
IT261442 C 04710 BRA nl/- 3/3 - R
IT284050 Peru-5438 CRI nl/- 3/3 - R
IT158662 K1 MYS -/mo 3/3 +++ S
IT158680 L.P.1 THA -/mo 3/3 +++ S

zInoculated leaf/upper leaf, mo, mottle; nl, necrotic local lesions.

yNo. of plant infected / No. of plant inoculated.

Table 4
Resistant Capsicum chinense accessions to Pepper mild mottle virus-P1,2,3
Table 4
IT no. PMMoV-P1,2,3
symptomz Incidencey RT-PCR Response
IT261210 nl/- 3/3 - R
IT261211 nl/- 3/3 - R
IT261426 nl/- 3/3 - R
IT261431 nl/- 3/3 - R
IT261442 nl/- 3/3 - R
IT284050 nl/- 3/3 - R

zInoculated leaf/upper leaf, mo, mottle; nl, necrotic local lesions.

yNo. of plant infected / No. of plant inoculated.

  • Alonso E, Garcia-Luque I, de la Cruz A, Wicke B, Avila- Rincon MJ, Serra MT, Castresana C, Diaz-Ruiz JR. 1991. Nucleotide sequence of the genomic RNA of pepper mild mottle virus, a resistance-breaking tobamovirus in pepper. J Gen Virol 72: 2875-2883.
  • Antignus Y, Lachman O, Pearlsman M, Maslenin L, Rosner A. 2008. A new pathotype of Pepper mild mottle virus (PMMoV) overcomes the L4 resistance genotype of pepper cultivars. Plant Dis 92: 1033-1037.
  • Betti L, Tanzi M, Canova A. 1986. Increased pathogenicity of TMV pepper strains after repeated passages in resistant capsicum accessions. Capsicum Newsl 5: 43-44.
  • Boukema IW. 1977. Resistance in capsicum to a pepper strain of TMV. Capsicum 77: 85-88.
  • Boukema IW. 1980. Allelism of genes controlling resistance to TMV in Capsicum L. Euphytica 29: 433-439.
  • Choi GS, Kim JH, Lee DH, Kim JS, Ryu KH. 2005. Occurrence and distribution of viruses infecting pepper in Korea. Plant Pathol J 21: 258-261.
  • Choi GS, Cho JD, Chung BN, Cho IS, Choi SK. 2011. Cause of the scion death in green pepper grafting system by a tobamovirus. Res Plant Dis 17: 191-195.
  • Choi GS, Choi SK, Cho JD, Cho IS. 2013. A pathotype of Pepper mild mottle virus causing necrotic spot symptoms in paprika fruit. Res Plant Dis 19: 124-127.
  • Choi GS, Choi SK, Cho IS, Kwon SJ. 2014. Resistance screening to Pepper mild mottle virus pathotypes in paprika cultivar. Res Plant Dis 20: 299-302.
  • Culver JN, Dawson WO. 1989a. Point mutations in the coat protein gene of tobacco mosaic virus induce hypersensitivity in Nicotiana sylvestris. Mol Plant Microbe In 2: 209-213.
  • Culver JN, Dawson WO. 1989b. Tobacco mosaic virus coat protein: An elicitor of the hypersensitive reaction but not required for the development of mosaic symptoms in Nnicotiana sylvestris. Virology 173: 755-758.
  • Flor HH. 1971. Current status of the gene for gene concept. Annu Rev Phytopathol 9: 275-296.
  • Garcia-Luque I, Ferrero ML, Rodriguez JM, Alonso E, de la Cruz A, Sanz AI, Vaquero MT, Serra MT, Diaz-Ruiz JR. 1993. The nucleotide sequence of the coat protein genes and 3' non-coding regions of two resistance breaking tobamoviruses in pepper show that they are different viruses. Arch Virol 131: 75-88.
  • Genda Y, Sato K, Nunomura O, Hirabayashi T, Ohnishi J, Tsuda S. 2005. Immunolocalization of Pepper mild mottle virus in Capsicum annuum seeds. J Gen Plant Pathol 71: 238-242.
  • Genda Y, Kanda A, Hamada H, Sato K, Ohnishi J, Tsuda S. 2007. Two amino acid substitutions in the coat protein of pepper mild mottle virus are responsible for overcoming the L4 gene-mediated resistance in Capsicum spp. Phytopathol 97: 787-793.
  • Grube RC, Radwanski ER, Jahn M. 2000. Comparative genetics of disease resistance within the Solanaceae. Genetics 155: 873-887.
  • Han JH, Lee Ch, La YJ. 2001. Pathotype of Tobamovirus isolates from commercial red pepper seeds. Korean J Hortic Sci Technol 19: 530-534.
  • Heath MC. 2000. Hypersensitive response-related death. Plant Mol Biol 44: 321-334.
  • Ikegashira Y, Ohki T, Ichiki UT, Higashi T, Hagiwara K, Omura T, Honda Y, Tsuda S. 2004. An immunological system for the detection of Pepper mild mottle virus in soil from green pepper fields. Plant Dis 88: 650-656.
  • Kim HJ, Han JH, Yoo JH, Cho HJ, Kim BD. 2008. Development of a sequence characteristic amplified region marker linked to the L4 locus conferring broad spectrum resistance to Tobamoviruses in pepper plants. Mol Cells 25: 205-210.
  • Lamb EM, Atkins S, Schuler KD, Roberts PD. 2001. Pepper mild mottle virus. University of Florida, IFAS Ext Bull 808.
  • Lee JD, Han JH, Yoon JB. 2012. A set of allele-specific markers linked to L locus resistant to Tobamovirus in Capsicum spp. Korean J Hort Sci Technol 30: 286-293.
  • Matsunaga H, Saito T, Hirai M, Nunome T, Yoshida T. 2003. DNA markers linked to pepper mild mottle virus (PMMoV) resistant locus (L4) in Capsicum. J Jap Soc Hortic Sci 72: 218-220.
  • Sugita T, Yamaguchi K, Sugimura Y, Nagata R, Yuji K, Kinishita T, Todoroki A. 2004. Development of SCAR markers linked to L3 gene in Capsicum. Breed Sci 54: 111-115.
  • Sawada H, Takeuchi S, Hamada H, Kiba A, Matsumoto M, Hikichi Y. 2004. A new tobamovirus-resistance gene L1a, of sweet pepper (Capsicum annuum L.). J Jap Soc Hortic Sci 73: 552-557.
  • Tomita R, Sekine KT, Mizumoto H, Sakamoto M, Murai J, Kiba A, Hikichi Y, Suzuki K, Kobayashi K. 2011. Genetic basis for the hierarchical interaction between Tobamovirus spp. and L resistance gene alleles from different pepper species. Mol Plant Microbe In 24: 108-117.
  • Yang HB, Liu WY, Kang WH, Jahn M, Kang BC. 2009. Development of SNP markers linked to the L locus in Capsicum spp. by a comparative genetic analysis. Mol Breeding 24: 433-446.
  • Yang HB, Liu WY, Kang WH, Kim JH, Cho HJ, Yoo JH, Kang BC. 2011. Development and validation of L allele specific markers in Capsicum. Mol Breeding 30: 819-829.
  • Wetter C, Conti M, Altschuh D, Tabillion R, van Regenmortel MHV. 1984. Pepper mild mottle virus a tobamovirus infecting pepper cultivars in Sicily. Phytopathology 74: 405-410.
  • Wetter C, Conti M. 1988. Pepper mild mottle virus. in: AAB descriptions of plant viruses. No. 330. Assoc Appl Biol, Warwick, UK.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3
Korean. J. Breed. Sci.. 2022;54(1):1-7.   Published online March 1, 2022
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3
Korean. J. Breed. Sci.. 2022;54(1):1-7.   Published online March 1, 2022
Close

Figure

  • 0
  • 1
  • 2
  • 3
Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3
Image Image Image Image
Fig. 1 Reverse transcription polymerase chain reaction (RT-PCR) for PMMoV in reference pepper germplasm. First lane, size marker; L0, Early California Wonder (Capsicum annuum); L1, Tisana (C. annuum); L2, CM334 (C. annuum); L3, PI159236 (C. chinense); L4, PI260429 (C. chacoense); P, positive control Inoculum N. occidentalis; N, negative control DW.
Fig. 2 Frequency distribution of disease incidence of 200 C. chinense to PMMoV-P1,2. Disease incidence (%)=No. of plant infected / No. of plant inoculated *100.
Fig. 3 Various symptoms of pepper plants with PMMoV pathotype P1,2. (A) Mosaic on the upper leaf, (B) Mottle on the upper leaf, (C) Whole necrosis, (D) Necrotic lesion in the inoculated leaf.
Fig. 4 Morphological characteristics of four C. chinense accessions resistant to PMMoV-P1,2,3. (A) IT261426, (B) IT261442, (C) IT284050, (D) IT261431.
Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3

Reference plant materials used in this study

IT no. Acc. name Species Genotype Reference Biological reaction P1,2z
IT158331 Early Califonia Wonder (ECW) C. annuum L0/L0 Boukema 1980 -/m, mo
IT158337 Tisana C. annuum L1/L1 Han et al. 2001 -/m, mo
IT250209 CM334 C. annuum L2/L2 Lee et al. 2012 -/m, mo
IT236726 PI159236 C. chinense L3/L3 Boukema 1980 nl/-
IT158713 PI260429 C. chacoense L4/L4 Boukema 1984 nl/-

Primer set used for confirmation of the PMMoV existence in samples

Primer name Sequence (5'-3') Loci Size (bp) Gene
PMMoV-5F AGGTTAGAATTGGGCAGAAC 5627-5646 684 CP (5685-6158)
PMMoV-5R ATTACGTCGTTCGCAAATAC 6310 -6291

Reactions of different Capsicum genotypes to infection with pepper mild mottle virus P1,2

IT no.. Acc. name Origin Resistance to PMMoV_NS-RP13
Symptomz Incidencey RT-PCR Response
IT261209 PI315014 PER nl/nl,- 3/3 - R
IT261210 PI315012 PER nl/- 3/3 - R
IT261211 PI315017 PER nl/- 3/3 - R
IT261221 Peru-5363 CRI nl/- 3/3 + R
IT261414 BISBAS YEM -/mo 3/3 +++ S
IT261426 VC112a UNK nl/- 3/3 - R
IT261431 TC 07589 ECU nl/- 3/3 - R
IT261442 C 04710 BRA nl/- 3/3 - R
IT284050 Peru-5438 CRI nl/- 3/3 - R
IT158662 K1 MYS -/mo 3/3 +++ S
IT158680 L.P.1 THA -/mo 3/3 +++ S

Resistant Capsicum chinense accessions to Pepper mild mottle virus-P1,2,3

IT no. PMMoV-P1,2,3
symptomz Incidencey RT-PCR Response
IT261210 nl/- 3/3 - R
IT261211 nl/- 3/3 - R
IT261426 nl/- 3/3 - R
IT261431 nl/- 3/3 - R
IT261442 nl/- 3/3 - R
IT284050 nl/- 3/3 - R
Table 1 Reference plant materials used in this study

znl: necrotic lesion, m: mosaic, mo: mottle

Table 2 Primer set used for confirmation of the PMMoV existence in samples
Table 3 Reactions of different Capsicum genotypes to infection with pepper mild mottle virus P1,2

zInoculated leaf/upper leaf, mo, mottle; nl, necrotic local lesions.

yNo. of plant infected / No. of plant inoculated.

Table 4 Resistant Capsicum chinense accessions to Pepper mild mottle virus-P1,2,3

zInoculated leaf/upper leaf, mo, mottle; nl, necrotic local lesions.

yNo. of plant infected / No. of plant inoculated.