Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

맥주보리의 Large-InDel 마커 개발을 위한 Whole Genome Re-Sequencing의 이용

김태헌1, 김양길1, 손재한2, 전재범3, 윤영미1,*

Utilization of Whole Genome Re-Sequencing for Large-InDel Markers Development in Malting Barley

Korean Journal of Breeding Science 2021;53(3):266-276.
Published online: September 1, 2021

1농촌진흥청 국립식량과학원 작물육종과

2농촌진흥청 국립식량과학원 중부작물과

3농촌진흥청 디지털농업추진단

1National Institute of Crop Science, RDA, Wanju, 55365, Republic of Korea

2Central Area Crop Breeding Division, RDA, Suwon, 16429, Republic of Korea

3Department of Digital Agriculture, RDA, Jeonju, 54875, Republic of Korea

*Corresponding Author (E-mail: mi3710@korea.kr, Tel: +82-63-238-5227, Fax: +82-63-238-5205)
• Received: July 14, 2021   • Revised: July 23, 2021   • Accepted: July 29, 2021

Copyright © 2021 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 251 Views
  • 0 Download
  • 1 Crossref
prev next
  • Barley is an economically important cereal crop grown under diverse environmental conditions and ranked fourth in terms of production volume. Barley is a diploid self-fertilizing plant with seven chromosomes, and has a 5.1 Gbp genome with more than 80% repeat sequences. Whole genome re-sequencing (WGR) has provided substantial information on sequence variation distributed on all chromosomes, such as single nucleotide polymorphisms, insertions, and deletions, which are used in the development of DNA markers. In this study, we performed WGR to detect sequence variations among six Korean malting varieties. An average of 92,552 insertions and deletions (InDels) were detected in these varieties in comparison to the high-quality reference genome sequences. The InDel density of the six Korean malting varieties ranged from 17 to 19 InDel/1Mbp with an average of 18 InDel/1Mbp. No InDel could be detected in 193 regions in all chromosomes except chr. unassigned. One interval with high-density InDel, more than 150 InDel/1Mbp, was located on the 1H, 3H, 6H, and 7H chromosomes. A total of 145 InDel markers were developed using 225 large-InDel markers, longer than 50 bp. Seventeen large-InDel makers showed polymorphisms among 31 malting barley varieties. These 31 malting barley varieties were divided into four groups based on phylogenetic analysis. These results presented a development method of agarose-resolvable large-InDel markers using WGR. Seventeen polymorphic large-InDel markers were used to conserve and identify barley germplasms. This vast information on sequence variation in six Korean malting barleys could be used for the development of DNA markers and marker-assisted selection.
보리(Hordeum vulgare L. subsp. vulgare)는 다양한 환경조건에서 재배되고 있는 세계 5대 주요 곡물작물 중 하나이다. 보리는 7개의 염색체를 가지는 2배체 자가수정 식물이며, 80% 이상이 반복서열로 이루어진 5.1 Gbp의 염색체 크기를 가진다(Bennett et al. 1982, IBGSC 2012). 세계 보리 생산량의 75%는 가축사료, 20%는 맥아, 나머지 5%는 가공식품의 원료로 이용되고 있다(Blake et al. 2011). 최근에는 보리의 기능성 성분 중 하나인 수용성 식이섬유 베타글루칸이 2형 당뇨병, 심혈관질환의 위험 감소, 콜레스테롤 수치 감소에 효과를 나타내는 것으로 알려졌다(Collins et al. 2010). 특히 식용으로 재배되는 대부분의 보리는 맥주 양조를 위한 과정과 맥아 제조에 이용된다. 경제적으로 중요한 작물인 보리의 안정적 재배를 위해 재해성, 내병성 및 맥아 품질이 우수한 보리의 품종 개발 요구가 증가되고 있다. 이러한 보리의 품종 개발을 위해서는 유용형질을 보유한 다양한 유전자원이 필요하다. 보리는 식물유전연구를 위한 모델 식물로 오랫동안 고려되어 왔으며 이에 따라 다양한 재배지역의 품종, 재래종 및 야생종을 포함하는 보리 유전자원을 쉽게 이용할 수 있다. 그리고 유전자원의 다양성을 높이기 위해 돌연변이 집단이 구축되어 여러 형질에 대한 특성 평가가 이루어져 있다(IBGSC 2012). 그러나 보리는 육종과 경작에 의한 오랜 재배화 기간 동안 유전적 다양성이 급격하게 줄어들었다. 또한 보리 품종은 야생보리 집단에 비해 유전적 변이의 크기가 적고, 야생보리의 약 40%에 해당하는 대립유전자만 육성된 품종에 존재하였고 희귀대립유전자 및 많은 유용유전자가 소실되었다(Ellis et al. 2000, Nevo & Chen 2010, Russell et al. 2004). 분자마커는 유전적 다양성 분석 및 유전자원보존에 매우 중요하며, 야생보리의 유용 대립유전자 탐색에 이용될 수 있다(Chabane et al. 2005, Zhang et al. 2014). 또한 유전자원을 육종에 이용하기 위해서는 분자마커와 유전체 정보가 매우 중요하다.
Restriction fragment length polymorphisms (RFLP) 마커를 이용하여 보리의 초기 유전자지도를 작성하였다(Shin et al. 1990). 또한 RFLP마커로 보리 단편이입 계통(introgression line)의 삽입된 염색체의 위치를 결정하였다(Pickering et al. 1995). 혼성화 방법을 이용하는 RFLP 마커는 시간과 노동이 많이 소요되어 사용이 불편한 단점이 있다. 한편 polymerase chain reaction (PCR) 기반의 단순 반복 염기서열(simple sequence repeat, SSR) 마커는 적은 양의 DNA를 요구하며 적은 비용으로 짧은 시간에 검정이 가능하다. Random amplified polymorphic DNA (RAPD)를 이용하여 보리의 녹병저항성과 연관된 마커를 선발하였다(Poulsen et al. 1995). Kleinhofs et al. (1993)은 amplified fragment length polymorphism (AFLP) 마커 96개 조합을 이용하여 L94 등 16개 보리 품종에서 다형성을 나타내는 마커 조합을 선발하였다. Li et al. (2003)Ramsay et al. (2000)은 보리의 유전체 라이브러리(genomic library)를 작성하고 염기서열 결정(sequencing)을 통해 선발된 연쇄 반복 염기서열(tandem repeat)를 이용하여 SSR 마커를 개발하였다. 최근에는 다양한 작물에서 생성된 대량의 발현유전자단편(expressed-sequence tag, EST) 정보를 이용할 수 있다(http://www.ncbi.nlm.nih.gov /dbEST 4). EST-SSR 마커를 개발하여 보리 품종 및 야생보리 간의 유전적 다양성, 집단구조를 분석하였다(Thiel et al. 2003, Zhang et al. 2014). 특히 EST 내 높은 수준으로 보존된 tandem repeat 영역으로 인해 EST-SSR 마커는 작물간에 서로 이용할 수 있는 가능성이 있다(Holton et al. 2002, Varshney et al. 2005). 국내에서도 한국 보리 품종 및 유전자원에 대한 유전적 다양성 분석을 위해 SSR 마커를 이용하였다(Baek et al. 2004, Kim et al. 2002, Kwon et al. 2011). 분자마커의 발달로 인해 적은 비용으로 대량 검정이 가능한 single nucleotide polymorphism (SNP), Diversity Arrays Technology (DArT) 마커 등이 개발되었다. 보리의 EST 및 PCR 산물에서 확인된 SNP를 Illumina GoldenGate assay (Illumina Inc.,San Diego, CA) 방법으로 유전자원과 교배집단의 유전형 분석에 이용하였다(Close et al. 2009, Sato & Takeda 2009). DaRT 마커는 염기서열 정보없이 수백 개의 유전자좌위에 존재하는 SNP, InDel (insertion-deletion) 등의 염기서열 변이를 동시에 분석할 수 있는 장점이 있다(Wenzl et al. 2004). DArT 마커를 개발하고 보리 교배집단에 대한 유전자지도작성과 보리 유전자원의 집단구조 및 전장유전체분석에 이용하였다(Alsop et al. 2011, Matthies et al. 2012).
보리의 유전체 정보 공개로 인해 보리의 유전 연구 및 육종 분야에 표준 유전체를 이용 할 수 있게 되었다. 그리고 표준 유전체 정보는 유전체 분석, 유전적 다양성 조사, 비교 유전체 및 진화 분야에 앞으로 이용 될 수 있다(IBGSC 2012, Mascher et al. 2017). 그리고 최근 sequencing 기술의 발달과 더불어 차세대 염기서열 분석(next generation sequencing, NGS)은 낮은 비용으로 빠른 시간에 유전자원 간의 염기서열 변이를 탐색할 수 있으며 이를 분자마커 개발에 이용 할 수 있게 하였다. Bayer et al. (2017)은 exome capture 정보를 표준유전체에 mapping하여 SNP를 분석하고 50k SNP chip을 개발하였다(Bayer et al. 2017). GBS (genoyping-by-sequencing)는 크기가 크고 복잡한 유전체 분석을 위해 개발되었으며, reduced representation 라이브러리를 이용한 염기서열 변이 분석과 더불어 대량의 분자마커를 개발할 수 있다. GBS를 통해 보리의 흰가루병 저항성, 잎녹병 저항성(RphMBR1012), 종피색(purple seed coat color: Psc)과 연관된 마커가 선발되었고(Fazlikhani et al. 2019, Hoseinzadeh et al. 2020, Yao et al. 2018), 전세계에서 수집된 보리 유전자원에 대한 다양성분석이 수행되었다(Milner et al. 2019). 그리고 벼, 옥수수, 콩, 조와 같은 다양한 작물에서 전장유전체 염기서열 재분석(whole genome re-sequencing, WGR)을 통한 InDel, 구조변이(structural variation, SV) 분자마커 개발과 이를 이용한 유전적 다양성 및 유전자원의 집단구조 분석이 이루어 지고 있다(Bai et al. 2013, Liu et al. 2015a, Liu et al. 2015b, Song et al. 2015, Zhang et al. 2017). 보리에서는 Morex와 Barke의 표준유전체에 염기서열 정보를 이용하여 두 품종 간에 존재하는 InDel을 분석하고 분자마커를 개발하였으며, 유전자지도를 작성하였다(Zhou et al. 2015). 이와 같이 보리 표준유전체 정보의 발표와 함께 NGS를 이용한 분자마커의 개발이 활발히 이루어지고 있다. 그러나 sequencing 기술의 발달로 그 비용이 감소하였으나 보리는 유전체 크기가 5 Gbp 정도로 매우 커서 여전히 비용이 많이 들며, 높은 비율로 존재하는 반복 서열로 인해 sequencing 이후 분석의 어려움이 있어 WGR을 통한 분자마커의 개발은 미흡한 실정이다.
본 실험은 한국 맥주보리 품종 간의 유연관계 분석과 품종 판별을 위한 분자마커 제작을 위해 백호 등 6개 품종에 대한 WGR을 수행하였다. 각 맥주보리 품종에 존재하는 InDel을 분석하고, 품종 특이적인 large-InDel을 이용하여 분자마커를 개발하였다. 맥주보리 31개 품종에 대해 다형성을 나타내는 large-InDel 마커를 이용하여 품종간 유전적 거리 분석과 품종 판별을 수행한 결과를 보고하는 바이다.
식물재료
국내 육성 맥주보리 품종인 백호 등 6개 품종을 WGR 수행 후 각 품종 특이적 InDel 분석을 위해 이용하였다(Supplementary Table 1). 맥주보리 6개 품종의 이삭 형태는 모두 2조이며, 파성은 진양보리, 호품, 흑호, 누리맥이 Ⅰ 그리고 광맥, 백호가 Ⅳ 였다.
라이브러리 제작 및 염기서열 분석
백호 등 6개 품종의 종자를 플라스틱 파종상자에 각각 파종하고 2주후 유묘의 잎을 샘플하여 genomic DNA 추출에 이용하였다. Genomic DNA는 Higene genomic DNA prep kit (Biofact co. Ltd, Korea)을 이용하여 제조사의 프로토콜에 따라 추출하였다. 각 보리품종의 genomic DNA에 대한 WGR은 Phygen (Gyeonggi-do, Korea)에 의뢰하였다. 추출한 genomic DNA는 Quant-iT™ PicoGreen® dsDNA assay kit (Invitrogen, USA)을 이용하여 Dropsense (Trinean, Belgium)로 정량을 하였으며, 농도는 20 ng, 총량은 2 μg 이상인 것만 이용하였다. 염기서열 분석을 위한 라이브러리 제작에는 TruSeq DNA PCR- free library prep kit (Illumina, Inc., San Diego, US-CA)을 사용하였다. 추출한 genomic DNA는 sonication을 통해 단편화 한 후, end-repair를 통해 5’ 말단에 인산화가된 blunt-ended dsDNA를 생성하였다. Bead를 이용하여 ~350 bp 크기의 단편만 선발하고 양말단에 poly-A tail을 생성하였으며, Truseq indexing adapter를 부착하여 paired end sequencing을 위한 라이브러리로 제작하였다. 제작된 라이브러리는 Illumina HiSeq X platform을 이용하여 sequencing을 수행하였다. 라이브러리를 flowcell에 로딩하고 bridge amplification 과정을 통하여 클러스터를 형성하였다. 이후 SBS (sequencing-by-synthesis) 방법을 이용하여 sequencing이 진행되었으며, 형광 신호를 염기서열 정보로 전환하였다.
Read의 표준유전체상 mapping 및 InDel 분석
각 보리품종에서 생산된 염기서열 정보로부터 phred quality score가 20 이하인 low-quality read와 중복 read를 Trimmomatic v. 0.38을 이용하여 제거하였다. Low-quality read와 중복 read가 제거되고 남은 high-quality read들을 Morex 표준유전체(Mascher et al. 2017)에 Burrows-Wheeler Aligner v. 0.7.17을 이용하여 mapping하였다. 이후 SAMtools v. 1.9를 이용하여 mapping이 되지 않거나 염색체상 여러 위치에 mapping된 read들을 제거하였다. 또한 Picard package v. 1.112를 이용하여 PCR duplicate를 제거하였다. Genome analysis Toolkit v. 3.5의 haplotypeCaller module를 이용하여 read의 염기서열을 결정하고 vcf 파일을 작성하였다. 표준유전체와 맥주보리 품종들 간의 InDel은 min coverage: 5, max coverage: 250, quality≥20, SNP 비율은 0.9 조건으로 분석하였다.
품종 특이적 large-InDel 선발 및 프라이머 설계
분석된 InDel을 이용하여 2.0% agarose gel에서 다형성 구분이 가능한 50 bp 이상의 특정 맥주보리 품종에서만 특이적인 크기를 가지는 large-InDel을 선발하였다. 선발된 품종 특이적 large-InDel의 ±500 bp의 인접 서열을 표준유전체 염기서열에서 추출하여 forward 및 reverse 프라이머를 설계하였다. 프라이머 설계는 Primer3를 이용하였으며, 길이는 17~25 mer, GC 비율은 50%, Tm은 50~60 °C, PCR 산물의 크기는 300~500 bp 조건으로 하였다. 설계된 프라이머의 특이성은 표준유전체 염기서열을 대상으로 BLASTN 분석을 통해 확인하였다.
Large-InDel 마커 검정
31개 맥주보리 품종(Supplementary Table 1)의 DNA 추출은 맥주보리 6개 품종의 sequencing 라이브러리 제작에 이용된 추출 방법과 동일하게 수행하였다. 각 맥주보리 품종에 대한 large-InDel 마커 검정을 위한 PCR 조성은 genomic DNA를 5 μL (20 ng/μL), Taq-polymerase는 0.1 μL (5 unit/μL, Inclone), 마커는 forward와 reverse를 각 1 μL (10 pmol/μL), dNTP는 0.5 μL (10 mM dNTP mix), 10×buffer는 2.4 μL, 전체 용량은 24 μL로 하였다. PCR 조건은 94℃ 5분 그리고 94℃ 30초, 58℃ 30초, 72℃ 1분으로 35 사이클 수행하였고, 마지막 증폭을 72℃에서 5분간 하였다. PCR 산물은 2% agarose gel에서 전기영동하여 UV조건에서 확인하였다.
맥주보리 품종의 계통수(phylogenetic tree) 분석
각 large-InDel 마커의 PCR 산물을 전기영동한 후 insertion 밴드는 ‘0’, deletion 밴드는 ‘1’로 변환하여 유전형을 조사하였다. Polymorphism information content (PIC) 값 및 Nei’s distance (Nei & Takezaki 1983)를 PowerMaker v3.25 (Liu & Muse 2005)을 이용하여 계산하였다. 계통수(phylogenetic tree)는 Nei’s distance를 이용한 UPGMA (unweighted pair group method using arithmetic average) 방법으로 MEGAⅩ (Kumar et al. 2018)를 사용하여 작성하였다.
국내 육성 맥주보리 품종의 whole genome re-sequencing
백호 등 6개 맥주보리 품종은 Illumina HiSeqX platform을 이용하여 368,894,520~624,036,920개 read와 55,703,072,520~ 94,229,574,920 bp의 염기서열을 생성하였다. 염기서열 정확도가 99%임을 나타내는 Q20은 6개 맥주보리 품종 평균 97%의 높은 수치를 나타내었다(Table 1). Raw data의 염기서열에서 low- quality read와 중복 read를 Trimmomatic을 이용하여 제거하고 337,298,954~572,775,358개 read와 48,931,317,035~83,888,403,648 bp의 trimmed 염기서열을 다시 생성하였다. 각 맥주보리 품종의 trimmed read를 표준유전체인 Morex에 mapping하였다. 그 결과 211,145,586~358,477,728개 read와 30,739,038,802~ 52,354,131,893 bp 염기가 보리 염색체에서 한 영역에만 특이적으로 mapping되어 맥주보리 6개 품종에서 6.36~10.83 범위와 평균 7.85의 depth를 나타냈으며, 누리맥은 생성된 염기서열이 52,354,131,893 bp로 가장 많아 depth 또한 10.83으로 가장 높았다. 백호 등 6개 맥주보리 품종은 평균 74.7%의 genome coverage를 보였다(Table 1).
InDel의 염색체상 분포 특성
백호 등 6개 맥주보리 품종에 대한 InDel을 분석하였다. 6개 맥주보리 품종 평균 92,552개 InDel이 존재하였다. 누리맥이 97,359개로 InDel이 가장 많았으며, 백호는 88,685개로 가장 적었다. 보리의 7개 염색체에 mapping되지 않은 염기서열인 chr. unassigned를 포함하였을 때 염색체 평균 11,569개의 InDel이 탐색되었다. InDel의 분포는 염색체별로 다르게 나타났는데 chr. unassigned를 제외하면 7H 염색체에서 품종 평균 19,554개로 가장 많은 InDel이 존재하였고, 4H에서 가장 적은 7,516개의 InDel 개수를 보였다(Fig. 1A). 맥주보리 6개 품종과 Morex genome 간의 비교를 통해 각 염색체에서 1 Mbp 간격으로 InDel의 밀도(InDel 개수/1 Mbp)를 조사하였다. InDel의 밀도 계산에는 1 Mbp보다 짧은 각 염색체의 마지막 영역도 포함하였다. 맥주보리 6개 품종의 InDel 밀도의 범위는 17~19개, 평균 18개였으며, 누리맥이 19개로 가장 높았으며, 백호가 17개로 가장 낮았다. 7H 염색체의 품종 평균 InDel 밀도가 30개로 가장 높았으며 chr. unassigned를 제외하면 4H 염색체가 12개로 가장 낮았다. 품종에 따른 염색체별 InDel의 분포는 비슷한 경향을 나타내었다. 그리고 염색체에 따라 InDel의 밀도가 차이를 나타낸 것과 같이 염색체 내에서도 InDel의 분포는 편중되어 나타났다. 맥주보리 6개 품종에서 공통으로 InDel이 존재하지 않는 영역의 개수는 chr. unassigned를 포함하였을 때 227개, chr. unassigned를 제외하면 193개였다. InDel이 존재하지 않는 영역의 길이가 10 Mbp 이상인 곳도 1H~7H 염색체에서 총 13개가 있었다. 특히 7H 염색체의 547~573 Mbp 영역은 InDel이 존재하지 않는 가장 긴 영역이었다. 또한 1H~7H의 각 염색체에서 InDel이 존재하지 않는 비율은 1H 염색체가 가장 낮은 4.1%, 2H 염색체가 23%로 가장 높게 나타났다(Fig. 1A). 한편 InDel의 밀도가 매우 높은 150개/Mbp 이상인 영역은 1H 염색체의 509~510 Mbp, 3H의 18~19 Mbp, 6H의 16~17 Mbp, 7H의 4~5 Mbp로 총 4군데 였다(Fig. 1A). Insertion과 deletion의 길이가 길수록 모든 품종에서 개수가 급격히 줄어드는 분포를 보였다(Fig. 1B). ±1 bp가 평균 62.7%로 비율이 가장 높았으며, 1~10 bp가 insertion과 deletion의 90% 이상을 차지하였다. 특히 >50 bp의 insertion개수는 >-50의 deletion보다 약 4배 많았다(Fig. 1B). Morex, Barke 및 Bowman의 염기서열 비교에서는 insertion과 deletion중 1~10 bp는 전체 InDel에서 62%를 차지하였고, 전체 InDel의 개수는 1,140개로(Zhou et al. 2015) 본 실험의 결과와 많은 차이를 나타내었다. 이는 염기서열 분석에 이용된 Morex와 국내 품종 간의 유전적인 차이가 더 크기 때문인 것으로 판단된다.
맥주보리 품종 특이적 InDel의 주석달기(annotation)
염기서열 분석을 통해 각 맥주보리 품종에 특이적인 InDel을 총 50,732개 선발하였다. 광맥이 가장 많은 17,895개의 품종 특이적인 InDel을 보유하였고, 진양보리는 1,357개로 가장 적었다(Table 2). 염색체 간 비교에서는 chr. unassigned를 포함하여 평균 566~11,489개의 품종 특이적 InDel이 염색체 별로 존재하였다. 94%에 해당하는 대부분의 품종 특이적 InDel은 염색체상의 intergenic 영역에 위치하였다. 아미노산을 암호화하는 CDS (coding sequene) 영역에는 5개의 InDel이 위치하여, CDS 영역에는 InDel이 거의 존재하지 않는 것으로 나타났다. 이중 3개가 아미노산 서열의 변이를 가져오는 비동의(non-synonymous)였다(Table 3). 벼, 조, 고추, 배추에서도 non-coding 영역에 위치한 InDel이 coding 영역에 위치한 InDel에 비해 높은 비율을 나타내었다(Bai et al. 2013, Guo et al. 2019, Liu et al. 2013, Liu et al. 2015a).
Agarose 기반 품종 특이적 large-InDel 마커 제작
Sequencing 기술의 발달과 함께 그 비용이 줄어들었으며 다양한 작물의 표준유전체 정보가 사용 가능해졌다(Appels et al. 2018, IBGSC 2012, IRGSP 2005, Mascher et al. 2017, Schmutz et al. 2010, Schnable et al. 2009). WGR을 통해 품종 및 유전자원 간에 대량의 염기서열 변이 정보인 SNP와 InDel을 이용하여 분자마커 개발 및 유전적 다양성 분석에 이용되고 있다(Bai et al. 2013, Liu et al. 2015a, Liu et al. 2015b, Song et al. 2015, Zhang et al. 2017). 염기서열 변이 중 SNP를 이용한 유전형 분석은 이를 위한 다소 복잡한 플랫폼과 고가의 장비가 필요하므로 agarose에서 유전형을 쉽게 확인할 수 있는 PCR 기반의 InDel 마커는 육종 및 연구분야에 매우 유용하다. Liu et al. (2015a)Lu et al. (2015)는 insertion과 deletion의 크기에 따라 agarose 또는 polyacrylamide를 이용한 전기영동으로 유전형 확인이 가능한 InDel 마커의 개발을 대안으로 제시하였다. 벼, 오이에서는 agarose 기반의 InDel 마커를 개발하였다(Adedze et al. 2021, Hu et al. 2020). 본 실험에서는 맥주보리 6개 품종 특이적 large-InDel을 이용하여 분자마커를 제작하였다. 분자마커 제작에는 agarose gel에서 판별이 용이할 수 있도록 50 bp 이상의 large-InDel을 총 228개 사용하였다. Hu et al. (2020)은 큰 단편인 30~55 bp의 insertion과 deletion은 1.5~2% agarose gel에서 쉽게 판별이 가능한 300~350 bp 크기의 증폭 산물을 가지는 InDel 마커 개발에 이용될 수 있다고 하였다. Large-InDel이 염색체 상에 위치하는 양편의 염기서열 정보를 Morex 표준유전체에서 얻어 forward, reverse 프라이머를 제작하였다. 프라이머는 17~25 mer, GC 비율은 50% 내외, PCR산물 크기를 300~500 bp가 되게 하였다. 228개 large-InDel 중 145개 large-InDel이 마커로 제작되었으며, 맥주보리 31개 품종에 다형성을 검정하였다. 품종 특이적인 145개 large-InDel 마커에 대한 맥주보리 31개 품종(Supplementary Table 1)의 PCR 산물을 전기영동하여, 단일 밴드이며 대립유전자형이 2개인 large-InDel 마커 17개를 선발하였다. 선발된 large-InDel 마커의 PIC value는 0.060~0.373으로 0.5 이상의 높은 PIC value를 가지는 마커는 없었다(Table 4). 이는 다형성을 나타내는 모든 large-InDel 마커가 2개의 대립유전자형을 가졌기 때문에 PIC value가 낮게 나온 것으로 판단된다. 선발된 50BH1H-2, 50HP5H-1및 50JY7H-2InDel 마커는 증폭 산물의 크기가 300~400 bp이며, 2% agarose gel에서 짧은 시간에 유전형 차이를 쉽게 확인할 수 있었다(Fig. 2). 한편 전기영동을 통해 선발된 다형성 마커의 비율은 11%로 나타났다. PCR 산물을 전기영동한 결과 증폭이 되지 않는 마커나 일부 증폭이 되지 않는 맥주보리 품종은 프라이머가 혼성화되는 부위의 염기서열이 Morex의 표준유전체 염기서열과 다른 변이가 존재하였기 때문인것으로 판단된다. 그리고 InDel의 크기가 다르거나 InDel이 존재하지 않는 원인은 낮은 depth 및 높은 비율의 반복서열 등으로 인한 염기서열 분석의 error 때문인것으로 추측된다.
large-InDel 마커를 이용한 맥주보리 품종의 phylogenetic tree 분석
맥주보리 31개 품종에 대한 다형성 분석을 통해 선발된 17개 large-InDel 마커는 진광보리와 제주보리를 제외한 나머지 품종을 서로 구분하였다. Phylogenetic tree를 작성한 결과 4개의 큰 그룹으로 분류되었다. Ⅰ 그룹은 Commander, Ⅱ 그룹은 백록 등 4개 품종, Ⅲ 그룹은 광맥, Ⅳ 그룹은 가장 큰 그룹으로 삼도보리 등 25개 품종이 포함되어 있었으며, 5개 하위그룹으로 다시 나누어졌다. 국외 맥주보리 품종인 Commander는 다른 30개 맥주보리 품종과의 유전적 거리가 가장 컸다. Scarlett, Baudin, 및 Stirling 국외 맥주보리 품종은 국내 품종과의 유전적 거리가 Commander에 비해 작았으며, Scarlett은 다진, 대영보리, 대아보리, 흑호와 함께 Ⅳ 그룹의 하위그룹을 형성하였고, Baudin과 Stirling은 백록, 누리맥과 함께 Ⅱ 그룹을 형성하였다. 진광보리의 교배조합은 두산8호/사천6호, 제주보리는 교배조합이 77460-B-180/수원212호로 품종 육성을 위해 교배된 모부본이 서로 다르나, 다형성을 나타내는 마커가 없어 유전적 거리가 0.0으로 나타났다. 추후에 InDel 마커 개발과 이를 이용한 다형성 분석 등의 실험이 추가로 수행되어야 할 것으로 판단된다. 기존에 보고된 국내 보리 품종 및 재래종을 이용한 유전적 다양성 분석에서는 국외에서 사용되고 있는 HVM SSR 마커를 대부분 이용하였으며 일부 국내 품종에서 개발된 SSR 마커도 같이 이용하였다(Baek et al. 2004, Kim et al. 2002, Kwon et al. 2011). SSR 마커는 본 실험에서 개발된 두개의 대립유전자형을 나타내는 large-InDel 마커에 비해 다수의 대립유전자형을 가졌기 때문에 PIC value가 더 높게 나타났다. Kwon et al. (2011)은 유전적 다양석 분석을 통해 국내 보리 품종이 2조와 6조로 구분이 된다고 하였으며, 2조 그룹 내에 삼도보리와 제주보리가 유전적으로 매우 유사하다고 하였다. 본 실험의 결과에서도 두 품종은 같은 하위 그룹에 분류되었다(Fig. 3). 특히 국외 품종인 Commander를 제외한 30개 품종은 유전적 거리가 크지 않았는데, 국내 맥주보리 품종을 육성하는데 사용된 품종 및 유전자원의 다양성이 낮았기 때문인 것으로 판단된다.
본 실험 결과에서 선발된 50 bp 이상의 large-InDel을 이용한 17개 InDel 마커는 2% agarose gel에서 다형성이 쉽게 구분되었으며, 국내에서 육성된 대부분의 맥주보리 품종을 구분하였다. 국외 품종인 Commander 등 4개 품종도 구분이 되어 맥주보리의 국내 품종간 및 국내 품종과 국외 품종의 구별이 가능해졌다. 이는 국내 보리 품종과의 구별을 통해 맥주보리 품종 육성을 위한 국외 품종 및 유전자원 도입에도 큰 도움이 될 것이다. 그리고 맥주보리 품종 및 유전자원간 종자 혼입 등의 방지를 통한 순계 유지로 유전자원 보전에도 큰 도움이 될 것으로 판단된다. 선발된 17개의 large-InDel 마커와 맥주보리의 중요 형질 간 상관관계 분석도 필요하며, 형질연관 분자마커가 개발된다면 마커를 이용한 계통 선발이 가능해질 것이다. 그리고 17개의 large-InDel 마커는 맥주보리를 포함하여 다른 보리 품종 및 유전자원에도 충분히 활용될 수 있을 것이다. 또한 WGR이 수행된 백호 등 6개 품종의 sequence 정보는 앞으로 보리 SNP 및 InDel 마커를 개발하기 위한 자료로 활용될 수 있을 것이며, 이를 이용한 고밀도 유전자지도 작성 및 분자마커를 이용한 선발(marker-assisted selection, MAS)에도 활용 될 수 있을 것이다.
맥주보리 6개 품종인, 백호, 흑호, 호품, 진양보리, 광맥 및 누리맥에 대한 WGR을 수행하여 368,894,520~624,036,920개 read와 55,703,072,520~94,229,574,920 bp의 염기서열을 생성하였다. WGR로 생성된 6개 품종의 raw data의 염기서열에서 low-quality read와 중복 read를 Trimmomatic v. 0.38을 이용하여 제거하고 337,298,954~572,775,358개 read와 48,931,317,035~ 83,888,403,648 bp의 trimmed 염기서열을 다시 생성하였다. 6개 맥주보리 품종 평균 92,552개 InDel이 존재하였으며, chr. unassigned를 포함하여 염색체 평균 11,569개의 InDel이 탐색되었다. 맥주보리 6개 품종의 InDel 밀도(InDel 개수/1 Mbp)의 범위는 17~19개, 평균 18개였다. 맥주보리 6개 품종에서 공통으로 InDel이 존재하지 않는 영역의 개수는 chr. unassigned를 포함하였을 때 227개 였으며, 제외하면 193개 였다. InDel의 밀도가 매우 높은 150개/Mbp 이상인 영역은 1H 염색체의 509~510 Mbp, 3H의 18~19 Mbp, 6H의 16~17 Mbp, 7H의 4~5 Mbp로 총 4군데 였다. 50 bp 이상의 품종 특이적인 총 228개 large-InDel을 이용하여 145개 InDel 마커를 제작하였다. 맥주보리 31개 품종에 대한 다형성 분석을 통해 17개 large-InDel 마커를 선발하였다. 17개 large-InDel 마커의 PIC value는 0.060~0.373으로 나타났다. Phylogenetic 분석을 한 결과 4개의 큰 그룹으로 분류되었다. Ⅰ 그룹은 Commander, Ⅱ 그룹은 백록 등 4개 품종, Ⅲ 그룹은 광맥, Ⅳ 그룹은 삼도보리 등 25개 품종이 포함되어 있었다.
본문의 Supplementary Table 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.
본 연구는 농촌진흥청 연구사업(과제명: 국내 육성 맥주보리 및 귀리의 품종 판별 분자마커 개발, 과제번호: PJ014209012021)에 의해 이루어진것임.
Fig. 1
The distributions of InDel detected between 6 Korean malting barley varieties and Morex. (A) Genome-wide distribution of InDels detected between 6 Korean malting barley varieties and Morex along 7 chromosomes and unknown chromosome. (A-a) Each circos represents the 7 chromosomes and unknown chromosome of H. vulgare. (A-b~A-g) Circos diagrams represent InDel density distributed on each chromosome in H. vulgare. with sliding windows of 1 Mbp. (A-b) Baegho. (A-c) Kwangmaeg. (A-d) Heugho. (A-e) Hopum. (A-f) Jinyangbori. (A-g) Nurimaeg. (B) The size distribution of insertions and deletions detected between 6 Korean malting barley varieties and Morex.
kjbs-53-266-f1.tif
Fig. 2
The electrophoresis of 3 large-InDel markers developed using ≥50 bp unique InDels identified between 6 Korean malting barley varieties and Morex. (A) 50BH1H-2. (B) 50HP5H-1. (C) 50JY7H-2. M: 100bp size marker. 1~31: malting barley varieties used in this study, presented in Supplementary Table 1.
kjbs-53-266-f2.tif
Fig. 3
Phylogenetic relationships of 31 malting barley varieties based on 17 large-InDel markers by unweighted pair group method with arithmetic mean (UPGMA) cluster analysis. The scale bar indicates the genetic distance.
kjbs-53-266-f3.tif
Table 1
Summary of the whole genome re-sequencing data from 6 Korean malting barley varieties mapped on the reference genome.
Table 1
Variety Raw data GC (%) Q20 (%) Trimmed data Mapped sites (≥1ⅹ) Coveragez (%, ≥1ⅹ) Unique Mapped
reads
Unique Mapped
bases (G)
Average Depth (x)
Reads Bases Reads Bases
Baegho 381,623,896 57,625,208,296 45.33 97.21 349,954,170 51,157,143,212 3,609,902,559 74.67 211,145,586 30,739,038,802 6.36
Heugho 368,894,520 55,703,072,520 44.13 96.71 337,298,954 48,931,317,035 3,556,629,274 73.57 225,856,360 32,646,145,093 6.75
Hopum 375,231,692 56,659,985,492 43.25 97.03 339,927,448 49,728,159,348 3,528,123,120 72.98 228,389,808 33,338,308,609 6.90
Jinyangbori 459,411,158 69,371,084,858 43.60 97.00 415,528,674 60,747,757,588 3,622,925,028 74.94 270,323,156 39,415,505,443 8.15
Kwangmaeg 483,584,162 73,021,208,462 43.88 96.82 436,794,186 63,853,842,734 3,629,680,786 75.08 285,828,020 41,691,539,837 8.62
Nurimaeg 624,036,920 94,229,574,920 44.13 97.22 572,775,358 83,888,403,648 3,715,825,654 76.86 358,477,728 52,354,131,893 10.83
Mean 448,797,058 67,768,355,758 44.05 97.00 408,713,132 59,717,770,594 3,610,514,404 74.68 263,336,776 38,364,111,613 7.85

zCoverage: Mapped sites/reference sites×100, reference genome size: 4,834,432,680 bp.

Table 2
The number of unique InDels at each of chromosomes in 6 Korean malting barley varieties.
Table 2
Variety Chr. 1 Chr. 2 Chr. 3 Chr. 4 Chr. 5 Chr. 6 Chr. 7 Chr. unassigned Total
Baegho 3,351 1,093 1,324 842 3,011 496 5,032 207 15,356
Heugho 1,379 0 3 717 1,429 1 2 17 3,548
Hopum 1,445 0 0 3 252 1 448 23 2,172
Jinyangbori 44 8 26 71 14 807 355 32 1,357
Kwangmaeg 5,195 26 170 2,069 300 8,726 1,206 203 17,895
Nurimaeg 10 459 6,411 459 1,389 1,458 134 84 10,404
Total 11,424 1,586 7,934 4,161 6,395 11,489 7,177 566 50,732
Table 3
Annotation of InDels identified between 6 Korean malting barley varieties and reference genome. InDels were classified based on the annotations of reference genome.
Table 3
Variety CDS Intron 5' UTR 3' UTR Intergenic Total
Non synonymous Synonymous
Baegho 1 0 936 96 115 14208 15356
Heugho 0 0 219 29 38 3262 3548
Hopum 0 1 131 10 16 2014 2172
Jinyangbori 0 0 167 13 10 1167 1357
Kwangmaeg 2 1 667 80 85 17060 17895
Nurimaeg 0 0 323 36 28 10017 10404
Total 3 2 2443 264 292 47728 50732
Table 4
Characteristics of newly developed 17 InDel markers using the whole genome re-sequencing data from 6 Korean malting barley varieties.
Table 4
Primer InDel
Position
Forward primer (5'-3') Reverse primer (5'-3') InDel
size
Expected product size (bp) PIC
50BH1H-2 1H (10,961,973) CACCCTGCATGAAAGAAAGTATG TCCTACATGTTCATAGAGCCATG -62 308 0.373
BH7H-2 7H (7,591,851) CTTGAAATCGGTATGAACAACCC TTAGAGCAAGTTAACTAGGGCTT -55 435 0.160
HH1H-9 1H (529,911,805) TTCATGGCTGCTATCCTTACAAT ATATCCTTGTAGCCAGTCCTTTC -76 358 0.289
HH4H-3 4H (4,226,207) GACTCTTGATCAACGATCGATCT GAAACTTAGGCGGTAGTTGGATA +59 438 0.353
HP1H-5 1H (267,927,828) TTTGCAAGACGTTACATTCATCG CTGTCCCATATACTCATGAGCAA -61 411 0.234
50HP5H-1 5H (7,476,116) TATAGGAAACGCTGAGATGTGAC AAACCAGTTCCTTGTATCACTCC -87 300 0.263
50HP5H-2 5H (15,653,913) TCCGTCCTCTATGCCTATGAATA GCGTCATGATATATGAGCATCTATG -58 353 0.327
50JY7H-2 7H (3,690,102) TCACACTCCCTTACCTCATAGAT GCTTGGCAGACTTAATTTACCAG -50 338 0.362
GM1H-10 1H (342,831,132) CAAGGATCTAAGCAAACATGCAA GATTAATCCAACGGTCATTGTGG -60 396 0.263
GM1H-17 1H (455,796,748) CTAGGGATATTCTGATCGGTTGG TTAGCATGCCTCAATCATACCAT +54 425 0.362
50GM4H-3 4H (38,957,934) ATCCTTATAAGTCATGCTCTGCC TGCATCCAACACTTCATGTCATC +73 356 0.160
GM6H-30 6H (383,582,843) GGAGAAGTCATCTTGTAAAGCCA CTCATGAGCATAAGTGATCCAGT -50 376 0.060
50GM6H-4 6H (48,302,999) AAATTCCTCCTACTGAACTGAGC GTGGAAATGAACTTGTTGGTGGT +54 320 0.342
NM3H-28 3H (400,954,841) TGACCAATGTTGTGATTGACAAA TCCTAAGGCTCCCTAGTTCAATA -81 419 0.200
NM3H-36 3H (517,324,260) GGGAGCACAAGATAACACCATTA TAAGCTGAAACCTCCTTGAAAGT -63 375 0.234
NM5H-3 5H (516,751,365) AACAATGACCACAACACTATTGC AAATGGAAGGAAAGCTGCTATAA -87 348 0.327
NM5H-6 5H (523,703,745) GATAGTATTAGGAGTTGCTCGCA CCGAAGAGACATGTACATTTGTT -53 365 0.160
  • Adedze YMN, Lu X, Xia Y, Sun Q, Nchongboh CG, Alam MA, Liu M, Yang X, Zhang W, Deng Z. 2021. Agarose- resolvable InDel markers based on whole genome re-sequencing in cucumber. Sci Rep 11: 1-12.
  • Alsop B, Farre A, Wenzl P, Wang J, Zhou M, Romagosa I, Kilian A, Steffenson B. 2011. Development of wild barley-derived DArT markers and their integration into a barley consensus map. Mol 27: 77-92.
  • Appels R, Eversole K, Stein N, Feuillet C, Keller B, Rogers J, Pozniak CJ, Choulet F, Distelfeld A, Poland J. 2018. Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 361: 6403.
  • Baek HJ, Yoon MS, Kim HH, Lee J, Park KL, Cho YH, Choi WY. 2004. Diversity and relationships among Korean barley (Hordeum vulgare L.) germplasm by microsatellite. Korean J Breed Sci 36: 249-259.
  • Bai H, Cao Y, Quan J, Dong L, Li Z, Zhu Y, Zhu L, Dong Z, Li D. 2013. Identifying the genome-wide sequence variations and developing new molecular markers for genetics research by re-sequencing a landrace cultivar of foxtail millet. PloS One 8: e73514.
  • Bayer MM, Rapazote-Flores P, Ganal M, Hedley PE, Macaulay M, Plieske J, Ramsay L, Russell J, Shaw PD, Thomas W. 2017. Development and evaluation of a barley 50k iSelect SNP array. Front Plant Sci 8: 1792
  • Bennett MD, Smith J, Heslop-Harrison J. 1982. Nuclear DNA amounts in angiosperms. P Roy Soc Lond B Bio 216: 179-199.
  • Blake T, Blake V, Bowman J, Abdel-Haleem H. In: Ullrich S 2011. Barley feed uses and quality improvement. (Ed). Barley: Production, improvement and uses. Wiley-Blackwell, UK: pp. 522-531.
  • Chabane K, Ablett G, Cordeiro G, Valkoun J, Henry R. 2005. EST versus genomic derived microsatellite markers for genotyping wild and cultivated barley. Genet Resour Crop Evol 52: 903-909.
  • Close TJ, Bhat PR, Lonardi S, Wu Y, Rostoks N, Ramsay L, Druka A, Stein N, Svensson JT, Wanamaker S. 2009. Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10: 1-13.
  • Collins HM, Burton RA, Topping DL, Liao ML, Bacic A, Fincher GB. 2010. Variability in fine structures of noncellulosic cell wall polysaccharides from cereal grains: Potential importance in human health and nutrition. Cereal Chem 87: 272-282.
  • Ellis RP, Forster BP, Robinson D, Handley L, Gordon DC, Russell JR, Powell W. 2000. Wild barley: A source of genes for crop improvement in the 21st century? J Exp Bot 51: 9-17.
  • Fazlikhani L, Keilwagen J, Kopahnke D, Deising H, Ordon F, Perovic D. 2019. High resolution mapping of RphMBR1012 conferring resistance to Puccinia hordei in barley (Hordeum vulgare L.). Front Plant Sci 10: 640
  • Guo G, Zhang G, Pan B, Diao W, Liu J, Ge W, Gao C, Zhang Y, Jiang C, Wang S. 2019. Development and application of InDel markers for Capsicum spp. based on whole-genome re-sequencing. Sci Rep 9: 1-14.
  • Holton TA, Christopher JT, McClure L, Harker N, Henry RJ. 2002. Identification and mapping of polymorphic SSR markers from expressed gene sequences of barley and wheat. Mol 9: 63-71.
  • Hoseinzadeh P, Ruge-Wehling B, Schweizer P, Stein N, Pidon H. 2020. High resolution mapping of a Hordeum bulbosum-derived powdery mildew resistance locus in barley using distinct homologous introgression lines. Front Plant Sci 11: 225
  • Hu W, Zhou T, Wang P, Wang B, Song J, Han Z, Chen L, Liu K, Xing Y. 2020. Development of whole-genome agarose-resolvable LInDel markers in Rice. Rice 13: 1-11.
  • International Barley Genome Sequencing Consortium (IBGSC)2012. A physical, genetic and functional sequence assembly of the barley genome. Nature 491: 711
  • International Rice Genome Sequencing Project (IRGSP)2005. The map-based sequence of the rice genome. Nature 436: 793
  • Kim HS, Park KG, Baek SB, Suh SJ, Nam JH. 2002. Genetic diversity of barley cultivars as revealed by SSR masker. Korean J Crop Sci 47: 379-383.
  • Kleinhofs A, Kilian A, Maroof MS, Biyashev RM, Hayes P, Chen F, Lapitan N, Fenwick A, Blake T, Kanazin V. 1993. A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome. Theor Appl Genet 86: 705-712.
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol 35: 1547
  • Kwon YS, Hong JH, Choi KJ. 2011. Genetic diversity of Korean barley (Hordeum vulgare L.) varieties using microsatellite markers. Korean J Breed Sci 43: 243-250.
  • Li J, Sjakste T, Röder M, Ganal M. 2003. Development and genetic mapping of 127 new microsatellite markers in barley. Theor Appl Genet 107: 1021-1027.
  • Liu B, Wang Y, Zhai W, Deng J, Wang H, Cui Y, Cheng F, Wang X, Wu J. 2013. Development of InDel markers for Brassica rapa based on whole-genome re-sequencing. Theor Appl Genet 126: 231-239.
  • Liu J, Li J, Qu J, Yan S. 2015a. Development of genome-wide insertion and deletion polymorphism markers from next-generation sequencing data in rice. Rice 8: 1-10.
  • Liu J, Qu J, Yang C, Tang D, Li J, Lan H, Rong T. 2015b. Development of genome-wide insertion and deletion markers for maize, based on next-generation sequencing data. BMC Genomics 16: 1-9.
  • Liu K, Muse SV. 2005. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 21: 2128-2129.
  • Lu C, Zou C, Zhang Y, Yu D, Cheng H, Jiang P, Yang W, Wang Q, Feng X, Prosper MA. 2015. Development of chromosome-specific markers with high polymorphism for allotetraploid cotton based on genome-wide characterization of simple sequence repeats in diploid cottons (Gossypium arboreum L. and Gossypium raimondii Ulbrich). BMC Genomics 16: 1-12.
  • Mascher M, Gundlach H, Himmelbach A, Beier S, Twardziok SO, Wicker T, Radchuk V, Dockter C, Hedley PE, Russell J. 2017. A chromosome conformation capture ordered sequence of the barley genome. Nature 544: 427-433.
  • Matthies IE, van Hintum T, Weise S, Röder MS. 2012. Population structure revealed by different marker types (SSR or DArT) has an impact on the results of genome-wide association mapping in European barley cultivars. Mol 30: 951-966.
  • Milner SG, Jost M, Taketa S, Mazón ER, Himmelbach A, Oppermann M, Weise S, Knüpffer H, Basterrechea M, König P. 2019. Genebank genomics highlights the diversity of a global barley collection. Nat Genet 51: 319-326.
  • Nei M, Takezaki N. 1983. Estimation of genetic distances and phylogenetic trees from DNA analysis. Procceeding of 5th World Congress Genetic Applied Livstock Production 21: 405-412.
  • Nevo E, Chen G. 2010. Drought and salt tolerances in wild relatives for wheat and barley improvement. Plant Cell Environ 33: 670-685.
  • Pickering R, Hill A, Michel M, Timmerman-Vaughan G. 1995. The transfer of a powdery mildew resistance gene from Hordeum bulbosum L to barley (H. vulgare L.) chromosome 2 (2I). Theor Appl Genet 91: 1288-1292.
  • Poulsen D, Henry R, Johnston R, Irwin J, Rees R. 1995. The use of bulk segregant analysis to identify a RAPD marker linked to leaf rust resistance in barley. Theor Appl Genet 91: 270-273.
  • Ramsay L, Macaulay M, Ivanissevich S, MacLean K, Cardle L, Fuller J, Edwards K, Tuvesson S, Morgante M, Massari A. 2000. A simple sequence repeat-based linkage map of barley. Genetics 156: 1997-2005.
  • Russell J, Booth A, Fuller J, Harrower B, Hedley P, Machray G, Powell W. 2004. A comparison of sequence-based polymorphism and haplotype content in transcribed and anonymous regions of the barley genome. Genome 47: 389-398.
  • Sato K, Takeda K. 2009. An application of high-throughput SNP genotyping for barley genome mapping and characterization of recombinant chromosome substitution lines. Theor Appl Genet 119: 613-619.
  • Schmutz J, Cannon SB, Schlueter J, Ma J, Mitros T, Nelson W, Hyten DL, Song Q, Thelen JJ, Cheng J. 2010. Genome sequence of the palaeopolyploid soybean. Nature 463: 178-183.
  • Schnable PS, Ware D, Fulton RS, Stein JC, Wei F, Pasternak S, Liang C, Zhang J, Fulton L, Graves TA. 2009. The B73 maize genome: complexity, diversity, and dynamics. Science 326: 1112-1115.
  • Shin JS, Chao S, Corpuz L, Blake T. 1990. A partial map of the barley genome incorporating restriction fragment length polymorphism, polymerase chain reaction, isozyme, and morphological marker loci. Genome 33: 803-810.
  • Song X, Wei H, Cheng W, Yang S, Zhao Y, Li X, Luo D, Zhang H, Feng X. 2015. Development of INDEL markers for genetic mapping based on whole genome resequencing in soybean. G3-Genes Genom Genet 5: 2793-2799.
  • Thiel T, Michalek W, Varshney R, Graner A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet 106: 411-422.
  • Varshney RK, Sigmund R, Börner A, Korzun V, Stein N, Sorrells ME, Langridge P, Graner A. 2005. Interspecific transferability and comparative mapping of barley EST-SSR markers in wheat, rye and rice. Plant Sci 168: 195-202.
  • Wenzl P, Carling J, Kudrna D, Jaccoud D, Huttner E, Kleinhofs A, Kilian A. 2004. Diversity arrays technology (DArT) for whole-genome profiling of barley. PNAS 101: 9915-9920.
  • Yao X, Wu K, Yao Y, Bai Y, Ye J, Chi D. 2018. Construction of a high-density genetic map: genotyping by sequencing (GBS) to map purple seed coat color (Psc) in hulless barley. Hereditas 155: 1-11.
  • Zhang M, Mao W, Zhang G, Wu F. 2014. Development and characterization of polymorphic EST-SSR and genomic SSR markers for Tibetan annual wild barley. PLoS One 9: e94881
  • Zhang T, Gu M, Liu Y, Lv Y, Zhou L, Lu H, Liang S, Bao H, Zhao H. 2017. Development of novel InDel markers and genetic diversity in Chenopodium quinoa through whole-genome re-sequencing. BMC Genomics 18: 1-15.
  • Zhou G, Zhang Q, Tan C, Zhang XQ, Li C. 2015. Development of genome-wide InDel markers and their integration with SSR, DArT and SNP markers in single barley map. BMC genomics 16: 1-8.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Utilization of Whole Genome Re-Sequencing for Large-InDel Markers Development in Malting Barley
Korean. J. Breed. Sci.. 2021;53(3):266-276.   Published online September 1, 2021
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Utilization of Whole Genome Re-Sequencing for Large-InDel Markers Development in Malting Barley
Korean. J. Breed. Sci.. 2021;53(3):266-276.   Published online September 1, 2021
Close

Figure

  • 0
  • 1
  • 2
Utilization of Whole Genome Re-Sequencing for Large-InDel Markers Development in Malting Barley
Image Image Image
Fig. 1 The distributions of InDel detected between 6 Korean malting barley varieties and Morex. (A) Genome-wide distribution of InDels detected between 6 Korean malting barley varieties and Morex along 7 chromosomes and unknown chromosome. (A-a) Each circos represents the 7 chromosomes and unknown chromosome of H. vulgare. (A-b~A-g) Circos diagrams represent InDel density distributed on each chromosome in H. vulgare. with sliding windows of 1 Mbp. (A-b) Baegho. (A-c) Kwangmaeg. (A-d) Heugho. (A-e) Hopum. (A-f) Jinyangbori. (A-g) Nurimaeg. (B) The size distribution of insertions and deletions detected between 6 Korean malting barley varieties and Morex.
Fig. 2 The electrophoresis of 3 large-InDel markers developed using ≥50 bp unique InDels identified between 6 Korean malting barley varieties and Morex. (A) 50BH1H-2. (B) 50HP5H-1. (C) 50JY7H-2. M: 100bp size marker. 1~31: malting barley varieties used in this study, presented in Supplementary Table 1.
Fig. 3 Phylogenetic relationships of 31 malting barley varieties based on 17 large-InDel markers by unweighted pair group method with arithmetic mean (UPGMA) cluster analysis. The scale bar indicates the genetic distance.
Utilization of Whole Genome Re-Sequencing for Large-InDel Markers Development in Malting Barley

Summary of the whole genome re-sequencing data from 6 Korean malting barley varieties mapped on the reference genome.

Variety Raw data GC (%) Q20 (%) Trimmed data Mapped sites (≥1ⅹ) Coveragez (%, ≥1ⅹ) Unique Mapped
reads
Unique Mapped
bases (G)
Average Depth (x)
Reads Bases Reads Bases
Baegho 381,623,896 57,625,208,296 45.33 97.21 349,954,170 51,157,143,212 3,609,902,559 74.67 211,145,586 30,739,038,802 6.36
Heugho 368,894,520 55,703,072,520 44.13 96.71 337,298,954 48,931,317,035 3,556,629,274 73.57 225,856,360 32,646,145,093 6.75
Hopum 375,231,692 56,659,985,492 43.25 97.03 339,927,448 49,728,159,348 3,528,123,120 72.98 228,389,808 33,338,308,609 6.90
Jinyangbori 459,411,158 69,371,084,858 43.60 97.00 415,528,674 60,747,757,588 3,622,925,028 74.94 270,323,156 39,415,505,443 8.15
Kwangmaeg 483,584,162 73,021,208,462 43.88 96.82 436,794,186 63,853,842,734 3,629,680,786 75.08 285,828,020 41,691,539,837 8.62
Nurimaeg 624,036,920 94,229,574,920 44.13 97.22 572,775,358 83,888,403,648 3,715,825,654 76.86 358,477,728 52,354,131,893 10.83
Mean 448,797,058 67,768,355,758 44.05 97.00 408,713,132 59,717,770,594 3,610,514,404 74.68 263,336,776 38,364,111,613 7.85

The number of unique InDels at each of chromosomes in 6 Korean malting barley varieties.

Variety Chr. 1 Chr. 2 Chr. 3 Chr. 4 Chr. 5 Chr. 6 Chr. 7 Chr. unassigned Total
Baegho 3,351 1,093 1,324 842 3,011 496 5,032 207 15,356
Heugho 1,379 0 3 717 1,429 1 2 17 3,548
Hopum 1,445 0 0 3 252 1 448 23 2,172
Jinyangbori 44 8 26 71 14 807 355 32 1,357
Kwangmaeg 5,195 26 170 2,069 300 8,726 1,206 203 17,895
Nurimaeg 10 459 6,411 459 1,389 1,458 134 84 10,404
Total 11,424 1,586 7,934 4,161 6,395 11,489 7,177 566 50,732

Annotation of InDels identified between 6 Korean malting barley varieties and reference genome. InDels were classified based on the annotations of reference genome.

Variety CDS Intron 5' UTR 3' UTR Intergenic Total
Non synonymous Synonymous
Baegho 1 0 936 96 115 14208 15356
Heugho 0 0 219 29 38 3262 3548
Hopum 0 1 131 10 16 2014 2172
Jinyangbori 0 0 167 13 10 1167 1357
Kwangmaeg 2 1 667 80 85 17060 17895
Nurimaeg 0 0 323 36 28 10017 10404
Total 3 2 2443 264 292 47728 50732

Characteristics of newly developed 17 InDel markers using the whole genome re-sequencing data from 6 Korean malting barley varieties.

Primer InDel
Position
Forward primer (5'-3') Reverse primer (5'-3') InDel
size
Expected product size (bp) PIC
50BH1H-2 1H (10,961,973) CACCCTGCATGAAAGAAAGTATG TCCTACATGTTCATAGAGCCATG -62 308 0.373
BH7H-2 7H (7,591,851) CTTGAAATCGGTATGAACAACCC TTAGAGCAAGTTAACTAGGGCTT -55 435 0.160
HH1H-9 1H (529,911,805) TTCATGGCTGCTATCCTTACAAT ATATCCTTGTAGCCAGTCCTTTC -76 358 0.289
HH4H-3 4H (4,226,207) GACTCTTGATCAACGATCGATCT GAAACTTAGGCGGTAGTTGGATA +59 438 0.353
HP1H-5 1H (267,927,828) TTTGCAAGACGTTACATTCATCG CTGTCCCATATACTCATGAGCAA -61 411 0.234
50HP5H-1 5H (7,476,116) TATAGGAAACGCTGAGATGTGAC AAACCAGTTCCTTGTATCACTCC -87 300 0.263
50HP5H-2 5H (15,653,913) TCCGTCCTCTATGCCTATGAATA GCGTCATGATATATGAGCATCTATG -58 353 0.327
50JY7H-2 7H (3,690,102) TCACACTCCCTTACCTCATAGAT GCTTGGCAGACTTAATTTACCAG -50 338 0.362
GM1H-10 1H (342,831,132) CAAGGATCTAAGCAAACATGCAA GATTAATCCAACGGTCATTGTGG -60 396 0.263
GM1H-17 1H (455,796,748) CTAGGGATATTCTGATCGGTTGG TTAGCATGCCTCAATCATACCAT +54 425 0.362
50GM4H-3 4H (38,957,934) ATCCTTATAAGTCATGCTCTGCC TGCATCCAACACTTCATGTCATC +73 356 0.160
GM6H-30 6H (383,582,843) GGAGAAGTCATCTTGTAAAGCCA CTCATGAGCATAAGTGATCCAGT -50 376 0.060
50GM6H-4 6H (48,302,999) AAATTCCTCCTACTGAACTGAGC GTGGAAATGAACTTGTTGGTGGT +54 320 0.342
NM3H-28 3H (400,954,841) TGACCAATGTTGTGATTGACAAA TCCTAAGGCTCCCTAGTTCAATA -81 419 0.200
NM3H-36 3H (517,324,260) GGGAGCACAAGATAACACCATTA TAAGCTGAAACCTCCTTGAAAGT -63 375 0.234
NM5H-3 5H (516,751,365) AACAATGACCACAACACTATTGC AAATGGAAGGAAAGCTGCTATAA -87 348 0.327
NM5H-6 5H (523,703,745) GATAGTATTAGGAGTTGCTCGCA CCGAAGAGACATGTACATTTGTT -53 365 0.160
Table 1 Summary of the whole genome re-sequencing data from 6 Korean malting barley varieties mapped on the reference genome.

zCoverage: Mapped sites/reference sites×100, reference genome size: 4,834,432,680 bp.

Table 2 The number of unique InDels at each of chromosomes in 6 Korean malting barley varieties.
Table 3 Annotation of InDels identified between 6 Korean malting barley varieties and reference genome. InDels were classified based on the annotations of reference genome.
Table 4 Characteristics of newly developed 17 InDel markers using the whole genome re-sequencing data from 6 Korean malting barley varieties.