Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

New Cultivar Developed

고품질 중간찰 향미벼 ‘골든퀸 3호’

장성규1, 이원도2, 박용진3, 이영상4, 이주현5, 서정환1, 조유현2,*, 권순욱1,*

Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma

Korean Journal of Breeding Science 2021;53(2):177-186.
Published online: June 1, 2021

1부산대학교 식물생명과학과

2농업회사법인 주식회사 시드피아

3공주대학교 식물자원학과

4순천향대학교 의료생명공학과

5건국대학교 식량자원과학과

1Department of Plant Bioscience, Pusan National University, Miryang 50463, Republic of Korea

2SEEDPIA Inc., Suwon, 16395, Republic of Korea

3Department of Plant Resources, Kongju National University, Yesan 32439, Republic of Korea

4Department of Medical Biotechnology, Soonchunhyang University, Asan 31583, Republic of Korea

5Department of Crop science, Konkuk University, Seoul 05029, Republic of Korea

*Corresponding Author (E-mail: jo0027@hotmail.com, Tel: +82-70-4125-7959, Fax: +82-504-031-0884)
*Co-corresponding Author (E-mail: swkwon@pusan.ac.kr, Tel: +82-55-350-5506, Fax: +82-55-350-5509)
• Received: May 3, 2021   • Revised: May 3, 2021   • Accepted: May 14, 2021

Copyright © 2021 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 280 Views
  • 0 Download
  • 2 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • ‘Jeongdami’, a Mid-late Maturing, Low-amylose, High Yielding Rice (Oryza sativa L.) Cultivar
    Eok-Keun Ahn, Kyung-Ho Kang, Hyang-Mi Park, Yong-Jae Won, Kuk-Hyun Jung, Woong-Jo Hyun, Yoon-Sung Lee, Ki-Young Kim, Mi-Jung Kim, Ji-Eun Kwak, Sang-Beom Lee, Kyeong-Hee Jang
    Korean Journal of Breeding Science.2025; 57(1): 29.     CrossRef
  • ‘Baekokhyang’, a Late Maturing Rice Cultivar with Aroma Adaptable in the Chungnam Plain Area
    Giwon Cho, Gyucheol Kim, Chongtae Chung, Tugsang Yun, Yeotae Yun
    Korean Journal of Breeding Science.2024; 56(1): 63.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma
Korean. J. Breed. Sci.. 2021;53(2):177-186.   Published online June 1, 2021
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma
Korean. J. Breed. Sci.. 2021;53(2):177-186.   Published online June 1, 2021
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma
Image Image Image Image Image
Fig. 1 Pedigree diagram of ‘Golden queen 3’.
Fig. 2 Genealogical diagram of ‘Golden queen 3’.
Fig. 3 Picture of ‘Golden queen 3’. (a): Rough rice- Hwayeong, (b): Brown rice- Hwayeong, (c): Rough rice- Golden queen 3, (d): Brown rice- Golden queen 3, (e): Plants - Golden queen 3. Scale bar is 10 mm.
Fig. 4 The sequencing of CDS regions in the Badh2(Os08g0424500) gene. (A) The position of primers and 1 bp insertion on the Badh2 gene. (B) List of primers used for sequencing. (C) The sequence alignment of PCR amplicons by primers P6F and P6R. The yellow box indicates 1 bp insertion on exon 14 of Golden queen 3.
Fig. 5 PCR band patterns to confirm waxy traits. The used markers are Indel marker (Ex2-23) and CAPS marker (Ex4-Wx-mq) to 10 materials. (A) Ex2-indel-23, (B) Ex4-Wx-mq. Lane 1-2, Non-glutinous rice (Ilpum, Jungsaenggold); Lane 3-4, Glutinous rice (Dongjinchal, Boseokchal); Lane 5-6, Low amylose rice (Baegjinju, Manmi); Lane 7-10, Low amylose rice of Wx-mq gene (Wolback, Jinsang, Jinsang 2, Golden queen 3); M: 100 bp ladder marker.
Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma

The list of rice varieties for GBSS I genes analysis.

Variety Heading date Amylose content (%) Ex2-Indel-23 Ex4-Wx-mq Reference
Ilpum 8.14 18.9 - - Yoon et al. 2012
Jungsaenggold 8.08 17.2 - - Cho et al. 2013
Donjinchal 8.13 4.5 Duplication - Yoon et al. 2015
Boseokchal 8.16 5.5 Duplication - Yoon et al. 2015
Baegjinju 8.23 9.1 - - Hong et al. 2012
Manmi 8.16 12.9 - - Song et al. 2010
Wolbaek 7.31 11.6 - + Won et al. 2012
Jinsang 8.12 11.9 - + Hong et al. 2014
Jinsang 2 8.25 12.2 - + Lee et al. 2018
Golden queen 3 8.13 12.5 - + This study

The list of DNA markers for GBSS I gene analysis.

Marker Forward Reverse Restriction enzyme Reference
Ex2-Indel23 TGCAGAGATCTTCCACAGCA GCTGGTCGTCACGCTGAG - Samart et al. 2003
Ex4-Wx-mq TGTGGCTGAGGTAGGAGC AACGCATCTGGTTGTCTTTGT NlaIII Wang et al. 2010

Major agronomic traits and yield components.

Variety Heading date Culm length (cm) (n=30)z Panicle length (cm) (n=30) No. of panicles per hill (n=30) No. of spikelets per panicle (n=30) 1,000 grain (brown rice) weight (g) (n=30)
Golden queen 3 8/13 75.7±1.5** 20.1±1.2* 14.7±1.1ns 104.8±4.3** 21.80±0.27**
Hwayeong 8/11 77.8±2.1 19.5±1.2 14.1±1.6 97.3±3.4 21.40±0.25

Response to physiological stress and pest resistance.

Variety Lodging in field (0-9) Leaf senescence at maturity Cold tolerance Neck blast Bacterial blight Rice stripe virus Brown plant hopper
Golden queen 3 3 Slow Mz M M S S
Hwayeong 3 Slow M M R R S

Grain characteristics of ‘Golden queen 3’.

Variety Brown rice Dehulling recovery (Brown/Rough, %) Grain yield (MT/ha)
Length (mm) (n=30)z Width (mm) (n=30) Thickness (mm) (n=30) L/W ratio
Golden queen 3 4.97±0.10ns 2.96±0.10* 2.09±0.07** 1.68 78.5 5.47
Hwayeong 5.01±0.14 2.90±0.10 2.02±0.06 1.73 77.3 5.16

Physicochemical properties and eating quality of ‘Golden queen 3’.

Variety Translucency (1~9) White core/belly (0~9) Amylose content (brown rice, %) Protein content (brown rice, %) Glossiness of cooked ricez
Golden queen 3 4 - 12.5 6.9 79
Hwayeong 1 0/1 18.2 7.5 61

Fatty acids composition of ‘Golden queen 3’.

Variety Saturated fatty acid (SFA, %) Unsaturated fatty acid (USFA, %)
C14:0 C16:0 C18:0 Total C18:1 C18:2 C18:3 Total
Golden queen 3 0.7 24.1 1.9 26.7 33.4 38.6 1.3 73.3
Hwayeong 0.7 24.7 2.1 27.5 32.2 39.1 1.2 72.5
Table 1 The list of rice varieties for GBSS I genes analysis.
Table 2 The list of DNA markers for GBSS I gene analysis.
Table 3 Major agronomic traits and yield components.

zNo. of plants evaluated, * and ** indicate significance at 0.05 and 0.01 levels, respectively. ns: No significant.

Table 4 Response to physiological stress and pest resistance.

zR: Resistant, M: Moderate, S: Susceptible

Table 5 Grain characteristics of ‘Golden queen 3’.

zNo. of plants evaluated, * and ** indicate significance at 0.05 and 0.01 levels, respectively. nsNo significant.

Table 6 Physicochemical properties and eating quality of ‘Golden queen 3’.

zGlossiness of cooked rice was measured by Toyo mito-meter

Table 7 Fatty acids composition of ‘Golden queen 3’.