Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

New Cultivar Developed

고품질 중간찰 향미벼 ‘골든퀸 3호’

장성규1, 이원도2, 박용진3, 이영상4, 이주현5, 서정환1, 조유현2,*, 권순욱1,*

Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma

Korean Journal of Breeding Science 2021;53(2):177-186.
Published online: June 1, 2021

1부산대학교 식물생명과학과

2농업회사법인 주식회사 시드피아

3공주대학교 식물자원학과

4순천향대학교 의료생명공학과

5건국대학교 식량자원과학과

1Department of Plant Bioscience, Pusan National University, Miryang 50463, Republic of Korea

2SEEDPIA Inc., Suwon, 16395, Republic of Korea

3Department of Plant Resources, Kongju National University, Yesan 32439, Republic of Korea

4Department of Medical Biotechnology, Soonchunhyang University, Asan 31583, Republic of Korea

5Department of Crop science, Konkuk University, Seoul 05029, Republic of Korea

*Corresponding Author (E-mail: jo0027@hotmail.com, Tel: +82-70-4125-7959, Fax: +82-504-031-0884)
*Co-corresponding Author (E-mail: swkwon@pusan.ac.kr, Tel: +82-55-350-5506, Fax: +82-55-350-5509)
• Received: May 3, 2021   • Revised: May 3, 2021   • Accepted: May 14, 2021

Copyright © 2021 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 18 Views
  • 0 Download
prev next
  • ‘Golden queen 3’, an aromatic rice variety, was developed by Seedpia inc. (Suwon, Korea) breeding company in 2014. This cultivar was derived from a cross between ‘HJ-11’, a high-yield, aromatic line, and ‘JCH33M-15-1-9-1’, which has a low amylose content. During the F3-F8 generation, breeding lines were selected using a pedigree breeding method. The most promising line (JS9-3-73-15-5-1-5-3-1-1) was advanced and named ‘SP005’ in 2013. This variety was headed on August 13, two days later than ‘Hwayeong’ in the ‘in middle plane’ is commonly used to distinguish rice cultivation areas in Korea, so I think it's no problem to the understanding for readers (including farmers). The culm and panicle lengths of this variety were 75.7 cm and 20.1 cm, respectively. It has approximately 14.7 tillers per hill and 104.8 spikelets per panicle, and the 1000-grain weight was 21.8 g. The yield performance was 5.47 MT/ha in the local adaptability test, and the amylose content of this variety was 12.5%. 2-Acetyl-1-pyrroline was detected as the major volatile ingredient in aromatic rice, and a 1 bp insertion on the 14th exon (badh2.7 allele) was identified in the Badh2 gene. (Registration No. 7308).
우리나라의 경제 수준 향상으로 먹거리도 수량에서 품질 방향으로 요구가 높아지고 있다. 벼의 육종목표는 다수성, 안정성, 및 양질성 등으로 대별할 수 있는데, 이러한 목표가 사회와 경제적 여건에 따라 다양하게 변화되고 있다. 최근에는 벼 재배 면적 및 쌀 소비량은 감소하는 실정이나 국민의 건강에 대한 관심 증대로 기능성 쌀의 수요는 증가하고 있는 추세이다(Ahn et al. 2015). 쌀 산업의 안정적인 미래를 확보하기 위해서는 기존 수량 및 품질 중심의 밥쌀 시장을 유지하는 것과 함께 쌀품질의 고급화와 다양화를 통해 새로운 부가가치를 창출하는 노력을 필요로 한다. 향미는 벼를 주식으로 하는 많은 나라에서 소비자 요구가 증가하는 것으로 알려져 있으며, 특히 동남아시아 국가에서는 이미 많은 전통 음식에 활용되고 있다. 인도와 파키스탄의 Basmati 쌀과 태국의 Jasmine 쌀은 대표적인 향미로 국내외적으로 기호성이 높아 높은 시장 가격을 형성하고 있다(Buttery et al. 1986, Nagaraju et al. 1975, Tripathi & Rao 1979).
국내에서도 쌀 용도의 다양화를 위해 향미 품종 육성에 대한 관심이 높아지면서 농촌진흥청에서는 ‘향미벼 1호’ 육성을 시작으로 ‘미향’, ‘향남’, ‘향미벼 2호’, ‘아랑향찰’, ‘설향찰’, ‘흑향’ 등이 육성된 바 있다(Kim et al. 2014). 최근에는 고기능성 유색미와 향미를 결합한 ‘선향흑미’(Kim et al. 2014), 가공용 다수계 향미 품종인 ‘효원 5호’(Lee et al. 2016), 도열병, 흰잎마름병, 줄무늬잎마름병 등 병 저항성과 품질 특성이 개선된 ‘아로미’ (RDA 2016), 철과 아연 함량이 높은 ‘향철아’가 육성되었다(Jeong et al. 2018).
향미의 방향성 화합물은 약 200여종 이상의 방향성 화합물이 분석되고 있으며, 그 중에서 향을 결정하는 중요한 방향성분으로는 2-acetyl-1-pyrroline (2AP)가 알려져 있다. (Bryant & McClung 2011, Mahmud et al. 2016, Lee & Kim 1999, Kim et al. 2008). 또한 벼에서 2AP 함량은 염색체 8번에 있는 Betaine aldehyde dehydrogenase (Badh2) 유전자에 의해 결정되는 것으로 알려져 있으며, Badh2내 15개 이상 다양한 염기서열 변이가 보고되었다(Shi et al. 2008, Amarawathi et al. 2008). He et al. (2015)은 국내외 향미 유전자원의 유전체 분석을 통해 Badh2 유전자내 신규 염기서열 변이 8개를 보고하였고, 7번 엑손의 8 bp deletion과 13번 엑손의 C/T 변이가 전체의 97% 정도를 포함한다고 하였다.
벼에서의 전분 특성은 큰 상업적 가치를 가지고 있어, 전분 생성의 메커니즘을 이해하는 것은 매우 중요하다. 배유에서 아밀로스와 아밀로펙틴의 합성에 관여하는 granule-bound starch synthase I (GBSS I)의 대립유전자형에 따라 전분의 내용물과 점탄성 등이 조절된다(Denyer et al. 2001, Sano et al. 1984). Wxa는 인디카 벼에서 메벼의 형질을 나타내며, Wxb는 자포니카 벼에서 메벼의 형질을 나타내고, 인디카 메벼의 아밀로스 함량은 23% 이상으로 자포니카 메벼(17%~20%)에 비해 높다. Wxin, WxopWxa에서 유래된 minor allele로 각각 GBSS I에서 Exon 6번의 A/C SNP (Tyr/Ser), Exon 4번의 A/G SNP (Asp166Gly)로 나타난다. WxmqWxb에서 ‘밀키퀸’ SNP 돌연변이가 일어난 곳으로, Exon 4번에서 G/A, Exon 5번에서 T/C가 보고되었다(Larkin & Park 2003, Liu et al. 2009, Mikami et al. 2008, Sato et al. 2002, Yang et al. 2018).
본 연구는 국내 재배 환경에 적합하며 한국인의 선호도가 높은 향 특성을 갖는 향미 품종의 개발을 위해 재배안전성이 우수한 ‘주남’과 향미의 교배 후대에서 선발된 향미계통(HJ-11)을 모본으로 하고 저아밀로스 계통인 ‘JCH33M-15-1-9-1’을 부본으로 인공교배하여 저아밀로스, 향미 특성을 갖는 ‘골든퀸 3호’를 개발하였기에 그 육성 경위와 주요 농업적 특성에 대해 보고하고자 한다.
생산력검점
본 시험은 ‘골든퀸 3호’를 공시하여 2013년부터 2014년까지 2년간 중서부평야 2개 지역에서 보통기 재배 하여 대조품종 ‘화영’과 주요 농업형질과 수량성에 대해 비교 검토하였다. 4월 15일에 파종하여 5월 20일에 30×15 cm의 재식거리로 이앙하였고, 시비량은 N-P-K=9-4.5-5.7 kg/10a로 시비하였다. 제초제는 초기 제초제 5월 16일, 중기 제초제 6월 2일에 살포하였고, 살균살충제는 이앙 당일과 8월 6일에 살포하였다. 표본 채취는 반복 당 30주씩 조사하였고, 시험구 배치는 난괴법 3반복으로 하였다.
현미 지방산 조성 분석
지방산 조성 분석은 Lee et al. (2016)의 방법에 따라 현미 가루 0.2 g을 one-step extraction-methylation 처리 후 heptane 층을 vial에 담아 Gas Chromatography (QP2010 Plus, Shimadzu, Japan)를 이용하여 분석하였다. Column은 SP-2560(100 m×0.25 mm)를 사용하였고, flame ionization detector(FID, 260℃)를 사용하여 검출하였다. 주입구 온도는 250℃로 하였고, split ratio는 20:1로 하였으며 column 온도는 초기 120℃에서 25분 동안 유지한 후, 분당 4℃씩 240℃까지 올린 후 23분간 유지하였다. 지방산 조성은 표준품(Grain FAME mixture, Supelco, USA)의 retention time과의 비교를 통하여 동정된 각 지방산 peak area의 상대적인 면적 비율(%)로 나타내었다(Cho et al. 2006). 대조 품종은 ‘화영’을 이용하였다.
향기 성분 분석
향기 성분의 분석은 Sriseadka et al. (2006)의 방법을 변형하여 수행되었다. 현미 가루 5 g을 headspace vial에 넣고, SPME(solid phase micro extraction)가 부착된 GC-MS(QP-2010 Ultra, Shimadzu, Japan)로 방향성 화합물을 확인하였다. Divinyl benzene/Carboxen/ PDMS (57348-U, SUPELCO, USA) fiber를 이용한 SPME 분석 시 80℃에서 20분간 예열한 시료를 동일 온도에서 20분간 향기 성분을 흡착한 후 이를 GCMS injector 내에서 10분간 탈착하였다. Column은 Rtx-5MS(30 m×0.25 mm)를 사용하였고, injection 온도는 250℃, ion source 온도는 200℃, interface 온도는 270℃로 하였으며, helium gas를 분당 1.04 mL 속도로 흘려주었다. 향기 성분의 동정은 Wiley(version 9) 및 NIST(version 14) mass spectral library를 활용하였으며, n-alkane(C8 - C20)을 이용한 retention index 정보를 추가로 적용하여 수행되었다. 향기 분석 시 대조 품종은 ‘추청’을 이용하였다.
향기 및 전분 특성 관련 유전자 분석
향기 및 전분 특성 관련 유전자 분석을 위해 2주 동안 자란 벼의 어린잎에서 Cetyl Trimethyl Ammonium Bromide (CTAB) 방법을 이용하여 DNA를 추출하였다(Kump & Javornik 1996). 추출된 DNA는 Nanodrop (NanoDrop Technologies, Inc., Wilmington, DE, USA)으로 농도와 순도를 측정하여 유전자 분석에 사용하였다.
‘골든퀸 3호’와 ‘추청’의 Badh2 유전자 염기서열분석을 위해 모든 exon 영역을 포함하도록 6쌍의 primer set를 제작하여 사용하였고(Fig. 4), ‘골든퀸 3호’와 메벼 2품종, 찰벼 2품종, 중간찰벼 5품종, 총 10개 품종(Table 1)에 대해 아밀로스 함량 관련 GBSS I 유전자 2번 엑손의 23 bp 중복 부위와 4번 엑손의 Wxmq SNP 변이 부위에 대해 평가하였다(Table 2).
Polymerase Chain Reation(PCR) 반응은 DNA 20 ng, 2 μl의 pair primer(10 pmol/μl), 1.6 μl dNTP mixture (2.5 mM), 2.0 μl의 10×PCR buffer (50 mM Tris-HCl, pH 9.0, 50 mM NaCl, 10 mM MgCl2), 0.2 μl Taq polymerase (5.0 unit/μl; BEAMS Bio, Korea)에 증류수를 첨가하여 총 반응액을 20 μl로 조정하였다. 염기서열분석을 위한 PCR 반응은 94℃ 5분 predenaturation 후, 94℃ 30초 denaturation, 57℃ 30초 annealing, 72℃ 1분 extension 과정을 34회 반복하였고 72℃ 5분의 post extension 과정으로 실시하였다. Badh2 부위의 PCR product는 Macrogen (Seoul, Korea)에 의뢰하여 염기서열을 분석하였고, Wxmq SNP 변이 부위에는 5 μl의 PCR product, 1 μl의 10X buffer, 5U의 NlaIII 제한효소 (500 unit/μl; BioLabs, England) 총 10 μl 반응액으로 37℃에서 2시간 동안 제한 효소를 처리하였다.
육성 경위
벼 신품종 ‘골든퀸 3호’는 우수한 향 특성이 가미된 고기능성 양질미 품종을 개발하기 위해 육성되었다. 본 연구기관에서 선발한 약한 정도의 향 특성을 갖는 계통 MLAR-53(mutant low aromatic rice)을 ‘추청’과 인공교배하여 저향 특성의 안정적인 계통(J-43)을 선발하였다. 선발된 계통(J-43)은 1999년 단간다수의 ‘주남’을 모본으로 교배하여 재배안전성이 개선된 저향 계통 ‘HJ-11’을 육성하였다. ‘HJ-11’은 2004년 하계에 ‘Yumetchkushi’와 ‘Milky queen’ 교배 후대에서 선발된 저아밀로스 특성의 양질미 계통 ‘JCH33M-15-1-9-1’과 교배하여 F1 종자를 수확하였다. 2004년 동계에 온실재배하여 육성된 F2 종자를 2005년부터 계통육종법에 따라 세대를 진전시키면서 현미 외관품위와 재배특성이 우수하고, 저향 및 저아밀로스미 특성을 갖는 ‘JS9-3-73-15-5-1-5-3-1-1’를 선발, 고정하였다. 선발된 계통에 ‘SP005’ 계통명을 부여하고, 2013년~2014년에 난괴법 3반복으로 생산력검정을 수행한 결과 품종의 균일성과 재배안정성을 확인하여 ‘골든퀸 3호’라고 명명하였다(Figs. 1, 2).
출수기 및 주요 농업적 특성
‘골든퀸 3호’의 출수기는 중부평야 보통기 보비재배 시 8월 13일로 대조품종인 ‘화영’보다 2일 늦은 중생종이다. 간장은 75.7 cm로 ‘화영’에 비해 2.1 cm 짧고, 이삭길이는 20.1 cm로 ‘화영’ 보다 길었으며, 포기당 이삭수는 14.7개로 ‘화영’과 비슷하였다. 이삭당 벼알 수는 104.8개로 대조품종의 97.3개 보다 7.5개 많았고, 현미천립중은 21.8 g으로 ‘화영’의 21.4 g 보다 무거웠다(Table 3).
생리장해 및 병해충 저항성
‘골든퀸 3호’는 못자리 불시출수는 관찰되지 않았고, 내냉성은 중 정도였다. 포장에서 도복에 중간 정도의 저항성을 보였고, 성숙기 엽노화는 느린 편이다. 목도열병과 흰잎마름병에도 중 정도의 저항성을 보였으나, 줄무늬잎마름병과 멸구에 대한 저항성은 없었다(Table 4).
도정 및 품질 특성
‘골든퀸 3호’는 현미길이가 4.97 mm로 ‘화영’의 5.01 mm과 비슷하고, 폭과 두께는 각각 2.96 mm, 2.09 mm로 대조품종의 2.90 mm, 2.02 mm 보다 더 넓고 두꺼우며, 장폭비는 1.68로 대조품종과 유사한 단원형 특성을 보였다. 정현비율은 대조품종과 비슷한 78.5% 수준이고, 수량성은 5.47 MT/ha로 대조품종 ‘화영’의 5.16 MT/ha보다 높았다(Table 5, Fig. 3).
미질 특성
‘골든퀸 3호’는 투명도 4로 ‘화영’의 1 보다 불투명하고, 현미의 아밀로스 함량에서 대조품종의 18.2% 보다 낮은 12.5%로 중간찰벼 특성을 보였고, 현미의 단백질 함량은 6.9%로 대조품종 보다 낮았다. 도요 식미기로 측정한 밥윤기치는 79로 대조 품종 61에 비해 대단히 높게 나타났다(Table 6).
지방산 조성
‘골든퀸 3호’의 지방산 조성은 linoleic acid(C18:2), oleic acid(C18:1), palmitic acid(C16:0) 순으로 각각 38.6% 33.4%, 24.1%였으며, 포화지방산은 26.7%, 불포화지방산은 73.3%로 나타났다(Table 7). 이는 대조품종인 ‘화영’과 비교할 때 oleic acid 함량은 다소 높고, palmitic acid와 linoleic acid의 조성은 낮은 경향이었다.
향기 성분 분석
‘골든퀸 3호’와 ‘추청’에서 탐색된 향기 관련 성분은 총 36개가 탐색되었다. 백미에서 29개, 현미에서 31개의 성분이 두 품종 모두에서 검출되었으며, 두 개의 성분은 두 품종에서 모두 현미에서만 공통적으로 검출되었다. 네 개의 성분이 ‘추청’에서만 특이적으로 검출되었고, ‘골든퀸 3호’에서는 2AP만 특이적으로 검출되었는데(Supplementary Table 1), 2AP는 향미의 향취성을 지배하는 성분이라고 보고되었다(Bryant & McClung 2011).
향기 성분(2AP) 관련 Badh2 유전자 분석
‘골든퀸 3호’의 주요 향 성분 2AP를 조절하는 Badh2 대립유전자형을 확인하기 위해 Badh2 유전자의 exon 영역을 대상으로 염기서열을 분석한 결과, ‘추청’은 변이가 없었지만 ‘골든퀸 3호’에서는 14번 exon에서 1 bp 삽입을 확인하였다(Fig. 4). ‘골든퀸 3호’에서 확인된 Badh2 유전자 변이는 다른 대립유전자들에 비해 중간 정도의 2AP 함량을 보이는 badh2.7 대립유전자의 변이와 동일하였다(Kovach et al. 2009). 이를 통해 ‘골든퀸 3호’의 향 특성은 badh2.7 대립유전자에 의해 나타남을 확인하였다.
전분 특성 관련 GBSS I 유전자 분석
‘골든퀸 3호’와 메벼 2품종, 찰벼 2품종, 중간찰벼 5품종, 총 10개 품종에 대해 Ex2-Indel-23 마커와 Ex4-Wx-mq 마커를 통해 각각의 GBSS I 유전자의 염기서열 변이를 확인하였다(Table 1). Ex2-Indel-23 마커 분석에서 찰벼인 ‘동진찰’과 ‘보석찰’에서만 23 bp 중복이 확인되었다. ‘밀키퀸’이 교배모본에 사용된 ‘월백’, ‘진상’, ‘진상 2호’, ‘골든퀸 3호’에서는 Ex4-Wx-mq 마커에서 ‘밀키퀸’ 돌연변이 유전자형을 보였고, ‘일품’ 돌연변이 후대에서 육성된 ‘백진주’와 ‘북륙반나’ 교배후대에서 육성된 ‘만미’에서는 해당 변이가 탐색되지 않았다(Table 1, Fig. 5). ‘골든퀸 3호’는 Ex2-Indel-23 마커 증폭 결과 메벼와 동일한 결과를 보였고, Ex4-Wx-mq 마커에서 ‘밀키퀸’ 돌연변이 유전자형을 보여 Wxmq에 의해 중간찰 특성이 나타남을 확인하였다.
‘골든퀸 3호’는 농업회사법인 주식회사 시드피아에서 2014년도에 육성한 구수한 향과 고품질, 재배 안정성을 가지는 중간찰 품종으로 주요 특성을 요약하면 다음과 같다. ‘골든퀸 3호’는 중서부평야 보통기 보비 재배시 출수기가 8월 13일로 ‘화영’ 보다 2일 늦은 중생종으로, 간장이 ‘화영’의 77.8 cm보다 작은 75.7 cm로 나타났고 목도열병과 흰잎마름병에 대해 중 정도의 저항성을 보였으나, 줄무늬잎마름병과 멸구에 대한 저항성은 없었다. ‘골든퀸 3호’의 정현비율은 78.5%로 대조품종과 비슷한 수준이며 현미길이가 4.97 mm로 대조품종의 5.01 mm와 비슷하고 폭과 두께는 각각 2.96 mm, 2.09 mm로 대조품종의 2.90 mm, 2.02 mm 보다 더 넓고 두꺼우며, 장폭비는 1.68로 대조품종과 유사한 단원형 특성을 보였다. 보통기 보비재배에서 수량성은 5.47 MT/ha로 대조품종의 5.16 MT/ha보다 높았으며, 아밀로스 함량은 12.5%로 대조품종의 18.2%보다 낮은 중간찰벼 특성을 보였다. 도요 식미기로 측정한 밥윤기치는 79로 대조품종보다 높게 나타났다. 지방산 조성은 linoleic acid(C18:2), oleic acid(C18:1), palmitic acid(C16:0) 순으로 각각 38.6% 33.4%, 24.1%였으며, 포화지방산은 26.7%, 불포화지방산은 73.3%로 나타났다. ‘골든퀸 3호’는 GBSS I 유전자내에 ‘밀키퀸’ 돌연변이와 동일한 유전자형을 가진 것을 확인하였고, badh2.7 대립 유전자에 의해 주요 향기 성분인 2AP(2-Acetyl-1-pyrroline)를 포함하는 향미 품종이다.
본문의 Supplementary Table 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.
본 결과물은 농림축산식품부의 재원으로 농림식품기술기획평가원의 농식품수출비즈니스 전략모델구축사업의 지원을 받아 연구되었음(320105-3).
Fig. 1
Pedigree diagram of ‘Golden queen 3’.
KJBS-53-177-f1.tif
Fig. 2
Genealogical diagram of ‘Golden queen 3’.
KJBS-53-177-f2.tif
Fig. 3
Picture of ‘Golden queen 3’. (a): Rough rice- Hwayeong, (b): Brown rice- Hwayeong, (c): Rough rice- Golden queen 3, (d): Brown rice- Golden queen 3, (e): Plants - Golden queen 3. Scale bar is 10 mm.
KJBS-53-177-f3.tif
Fig. 4
The sequencing of CDS regions in the Badh2(Os08g0424500) gene. (A) The position of primers and 1 bp insertion on the Badh2 gene. (B) List of primers used for sequencing. (C) The sequence alignment of PCR amplicons by primers P6F and P6R. The yellow box indicates 1 bp insertion on exon 14 of Golden queen 3.
KJBS-53-177-f4.tif
Fig. 5
PCR band patterns to confirm waxy traits. The used markers are Indel marker (Ex2-23) and CAPS marker (Ex4-Wx-mq) to 10 materials. (A) Ex2-indel-23, (B) Ex4-Wx-mq. Lane 1-2, Non-glutinous rice (Ilpum, Jungsaenggold); Lane 3-4, Glutinous rice (Dongjinchal, Boseokchal); Lane 5-6, Low amylose rice (Baegjinju, Manmi); Lane 7-10, Low amylose rice of Wx-mq gene (Wolback, Jinsang, Jinsang 2, Golden queen 3); M: 100 bp ladder marker.
KJBS-53-177-f5.tif
Table 1
The list of rice varieties for GBSS I genes analysis.
Table 1
Variety Heading date Amylose content (%) Ex2-Indel-23 Ex4-Wx-mq Reference
Ilpum 8.14 18.9 - - Yoon et al. 2012
Jungsaenggold 8.08 17.2 - - Cho et al. 2013
Donjinchal 8.13 4.5 Duplication - Yoon et al. 2015
Boseokchal 8.16 5.5 Duplication - Yoon et al. 2015
Baegjinju 8.23 9.1 - - Hong et al. 2012
Manmi 8.16 12.9 - - Song et al. 2010
Wolbaek 7.31 11.6 - + Won et al. 2012
Jinsang 8.12 11.9 - + Hong et al. 2014
Jinsang 2 8.25 12.2 - + Lee et al. 2018
Golden queen 3 8.13 12.5 - + This study
Table 2
The list of DNA markers for GBSS I gene analysis.
Table 2
Marker Forward Reverse Restriction enzyme Reference
Ex2-Indel23 TGCAGAGATCTTCCACAGCA GCTGGTCGTCACGCTGAG - Samart et al. 2003
Ex4-Wx-mq TGTGGCTGAGGTAGGAGC AACGCATCTGGTTGTCTTTGT NlaIII Wang et al. 2010
Table 3
Major agronomic traits and yield components.
Table 3
Variety Heading date Culm length (cm) (n=30)z Panicle length (cm) (n=30) No. of panicles per hill (n=30) No. of spikelets per panicle (n=30) 1,000 grain (brown rice) weight (g) (n=30)
Golden queen 3 8/13 75.7±1.5** 20.1±1.2* 14.7±1.1ns 104.8±4.3** 21.80±0.27**
Hwayeong 8/11 77.8±2.1 19.5±1.2 14.1±1.6 97.3±3.4 21.40±0.25

zNo. of plants evaluated, * and ** indicate significance at 0.05 and 0.01 levels, respectively. ns: No significant.

Table 4
Response to physiological stress and pest resistance.
Table 4
Variety Lodging in field (0-9) Leaf senescence at maturity Cold tolerance Neck blast Bacterial blight Rice stripe virus Brown plant hopper
Golden queen 3 3 Slow Mz M M S S
Hwayeong 3 Slow M M R R S

zR: Resistant, M: Moderate, S: Susceptible

Table 5
Grain characteristics of ‘Golden queen 3’.
Table 5
Variety Brown rice Dehulling recovery (Brown/Rough, %) Grain yield (MT/ha)
Length (mm) (n=30)z Width (mm) (n=30) Thickness (mm) (n=30) L/W ratio
Golden queen 3 4.97±0.10ns 2.96±0.10* 2.09±0.07** 1.68 78.5 5.47
Hwayeong 5.01±0.14 2.90±0.10 2.02±0.06 1.73 77.3 5.16

zNo. of plants evaluated, * and ** indicate significance at 0.05 and 0.01 levels, respectively. nsNo significant.

Table 6
Physicochemical properties and eating quality of ‘Golden queen 3’.
Table 6
Variety Translucency (1~9) White core/belly (0~9) Amylose content (brown rice, %) Protein content (brown rice, %) Glossiness of cooked ricez
Golden queen 3 4 - 12.5 6.9 79
Hwayeong 1 0/1 18.2 7.5 61

zGlossiness of cooked rice was measured by Toyo mito-meter

Table 7
Fatty acids composition of ‘Golden queen 3’.
Table 7
Variety Saturated fatty acid (SFA, %) Unsaturated fatty acid (USFA, %)
C14:0 C16:0 C18:0 Total C18:1 C18:2 C18:3 Total
Golden queen 3 0.7 24.1 1.9 26.7 33.4 38.6 1.3 73.3
Hwayeong 0.7 24.7 2.1 27.5 32.2 39.1 1.2 72.5
  • Ahn EK, Lee JH, Lee SB, Yang CI, Choi YH, Chang JK, Jeong JM, Lee GS, Kim MK, Kim JH, Hyun UJ, Mo YJ, Yoon YH, Jeung JU, Oh SK, Seo MW, Kim CK. 2015. Late-maturing, high biomass and multiple disease resistant whole crop silage rice cultivar 'Jungmo1029'. Korean J Crop Sci 47: 159-165.
  • Amarawathi Y, Singh R., Singh AK, Singh VP, Mohapatra T, Sharma TR, Singh NK. 2008. Mapping of quantitative trait loci for basmati quality traits in rice (Oryza sativa L.). Molecular Breeding 21: 49-65.
  • Bryant RJ, McClung AM. 2011. Volatile profiles of aromatic and non-aromatic rice cultivars using SPME/GC-MS. Food Chemistry 124: 501-513.
  • Buttery RG, Turnbaugh JG, Ling LC. 1986. Contribution of volatiles to rice aroma. J Agric Food Chem 36: 1006-1009.
  • Cho KS, Kim HJ, Moon SM, Kang JH, Lee YS. 2006. Optimization of one-step extraction/methylation method for analysis of fatty acid composition in brown rice. Korea J Crop Sci 51: 89-94.
  • Cho YC, Kim MK, Kim YG, Choi IS, Yang CI, Oh MG, Lee JH, Kim JJ, Suh JP, Won YJ, Hwang KH, Oh SK, Lee JH, Chang JK, Roh JH, Lee CK, Ahn EK, Jeong EG. 2013. A medium maturing, high quality, multiple resistant and middle plain area adaptable rice 'Jungsaenggold'. Korean J Breed Sci 45: 457-462.
  • Denyer K, Johnson P, Zeeman S, Smith AM. 2001. The control of amylose synthesis. J Plant Physiol 158: 479-487.
  • He Q, Yu J, Kim TS, Cho YH, Lee YS, Park YJ. 2015. Resequencing reveals different domestication rate for BADH1 and BADH2 in rice (Oryza sativa). PLoS ONE 10: e0134801. doi:10.1371/journal.pone.0134801.
  • Hong HC, Choi HC, Hwang HG, Kim YG, Moon HP, Kim HY, Yea JD, Shin YS, Choi YH, Cho YC, Baek MK, Lee JH, Yang CI, Jeong KH, Ahn SN, Yang SJ. 2012. A lodging-tolerance and dull rice cultivar 'Baegjinju'. Korean J Breed Sci 44: 51-56.
  • Hong WJ, Yoon MY, Ra WH, Park JW, Min SK, Kwon SW, Cho YH, Park YJ. 2014. A new variety 'Jinsang' with lodging tolerant and low amylose content. Korean J Breed Sci 46: 103-107.
  • Jeong EG, Ahn EK, Won YJ, Lee JH, Lee SB, Jeong JM, Oh SK, Choi YH, Lee JH, Suh JP, Hyun UJ, Jung OY, Kim BK, Son JY. 2018. 'Hyangcheola', a new fragrant rice variety with high iron and zinc content. Korean J Breed Sci 50: 472-477.
  • Inukai T, Sako A, Hirano HY, Sano Y. 2000. Analysis of intragenic recombination at wx in rice: Correlation between the molecular and genetic map within the locus. Genome 43: 589-596.
  • Kim JS, Park OS, Ahn SN, Lee JR, Gwag JG, Kim TS, Lee SY. 2008. Quantification of 2-acetyl-1-pyrroline from the aroma rice germplasm by gas chromatography. Korean J Food Sci 40: 516-521.
  • Kim MK, Lee SB, Lee JH, Jeong OY, Jeong JM, Shin YS, Yang CI, Kim YG, Lee KS, Choi YH, Park HM, Oh SK, Jeung JU, Kang KH, Chang JK, Kim DJ. 2014. A medium-maturing, black pericarp and aromatic rice variety 'Sheonhyangheukmi'. Korean J Breed Sci 46: 166-171.
  • Kovach MJ, Calingacion MN, Fitzgerald MA, McCouch SR. 2009. The origin and evolution of fragrance in rice (Oryza sativa L.). PNAS 106: 14444-14449. doi:10.1073/pnas.0904077106.
  • Kump B, Javornik B. 1996. Evaluation of genetic variability among common buckwheat (Fagopyrum esculentum Moench) populations by RAPD markers. Plant Science 114: 149-158.
  • Larkin PD, Park WD. 2003. Association of waxy gene single nucleotide polymorphism with starch characteristics in rice. Mol Breed 12: 335-339.
  • Lee JC, Kim YH. 1999. Comparison of volatile flavor components of korean aromatic rice and nonaromatic rice. J Korean Soc Food Sci Nutr 28: 299-304.
  • Lee WD, Park YJ, Jang SG, Kwon SW, Lee YS, Cho YH. 2018. Late-maturing, low amylose rice variety jinsang 2 with a medium to short culm. Korean J Breed Sci 50: 344-349.
  • Lee YS, Park YJ, Cho YH, Park SY, Kwon SW. 2016. Medium maturing high-yield rice variety with aroma, 'Hyowon 5'. Korean J Breed Sci 48: 390-397.
  • Liu L, Ma X, Liu S, Zhu C, Jiang L, Wang Y, Shen Y, Ren Y, Dong H, Chen L, Liu X, Zhao Z, Zhai H, Wan J. 2009. Identification and characterization of a novel Waxy allele from a Yunnan rice landrace. Plant Mol Biol 71: 609-626.
  • Mahmud MMC, Das AC, Lee SK, Kim TH, Oh Y, Cho YH, Lee YS. 2016. Germination-induced changes in favoring compound profiles and phytonutrient contents in scented rice. Korean J Crop Sci 61: 242-250.
  • Mikami I, Uwatoko N, Ikeda Y, Yamaguchi J, Hirano HY, Suzuki Y, Sano Y. 2008. Allelic diversification at the wx locus in landraces of Asian rice. Theor Appl Genet 116: 979-989.
  • Nagaraju M, Chaudhary D, Balakrishna Rao MJ. 1975. A simple technique to identify scent in rice and inheritance pattern of scent. Curr Sci 44: 599.
  • Rural Development Administration (RDA). 2016. Aromi. Available from: http://www.nongsaro.go.kr/portal/. Assessed December 7. 2020
  • Rural Development Administration (RDA)2011a. 2011 Project plan for collaborative research program to develop new variety of summer crops.
  • Rural Development Administration (RDA)2011b. 2011 Project report for collaborative research program to develop new variety of summer crops.
  • Sano Y. 1984. Differential regulation of waxy expression in rice endosperm. Theor Appl Genet 68: 467-473.
  • Sato H, Suzuki Y, Sakai M, Imbe T. 2002. Molecular characterization of Wx-mq, a novel mutant gene for low-amylose content in endosperm of rice (Oryza sativa L.). Breed Sci 52: 131-135.
  • Shi W, Yang Y, Chen S, Xu M. 2008. Discovery of a new fragrance allele and the development of functional markers for the breeding of fragrant rice varieties. Molecular Breeding 22: 185-192.
  • Song YC, Lee JH, Lee JS, Ha WG, Park NB, Kwak DY, Jung KH, Oh BG, Yeo US, Kang JR, Yi GH, Jang JK, Nam MH, Lim SJ, Kwon OK, Hwang HG. 2010. A new rice variety with low amylose, 'Manmibyeo'. Korean J Breed Sci 42: 257-261.
  • Sriseadka T, Wongpornchai S, Kitsawatpaiboon P. 2006. Rapid method for quantitative analysis of the aroma impact compound, 2-acetyl-1-pyrroline, in fragrant rice using automated headspace gas chr omatography. J Agric Food Chem 54: 8183-8189.
  • Tripathi RS, Rao MJBK. 1979. Inheritance and linkage relationship of scent in rice. Euphytica 28: 319-323.
  • Won YJ, Shin YS, Ahn EK, Kim MK, Kim YG, Hwang HG, Yoon YH, Jeon YH, Yoon KS, Yoon MR, Lee JH, Oh MK, Jeong JM, Yang WH, Jung KH. 2012. An early-maturing, blast resistant and semi-transparent low amylose rice variety 'Wolbaek'. Korean J Breed Sci 44: 379-383.
  • Yang B, Xu S, Xu L, You H, Xiang X. 2018. Effects of Wx and its interaction with SSIII-2 on rice eating and cooking qualities. Front Plant Sci 9: 456
  • Yoon MR, Chun AR, Oh SK, Hong HC, Choi IS, Lee JH, Cho YC, Kim YG. 2012. Physicochemical characteristics of starches in rice cultivars of diverse amylose contents. Korean J Crop Sci 57: 226-232.
  • Yoon MR, Lee JS, Kwak JE, Lee JH, Chun JB, Yang CI, Cho JH, Kim MJ, Lee CK, Kim BK, Kim WH. 2015. Starch and pasting characteristics in relation to stickiness of rice cake using glutinous rice varieties. Korean J Breed Sci 47: 199-208.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma
Korean. J. Breed. Sci.. 2021;53(2):177-186.   Published online June 1, 2021
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma
Korean. J. Breed. Sci.. 2021;53(2):177-186.   Published online June 1, 2021
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma
Image Image Image Image Image
Fig. 1 Pedigree diagram of ‘Golden queen 3’.
Fig. 2 Genealogical diagram of ‘Golden queen 3’.
Fig. 3 Picture of ‘Golden queen 3’. (a): Rough rice- Hwayeong, (b): Brown rice- Hwayeong, (c): Rough rice- Golden queen 3, (d): Brown rice- Golden queen 3, (e): Plants - Golden queen 3. Scale bar is 10 mm.
Fig. 4 The sequencing of CDS regions in the Badh2(Os08g0424500) gene. (A) The position of primers and 1 bp insertion on the Badh2 gene. (B) List of primers used for sequencing. (C) The sequence alignment of PCR amplicons by primers P6F and P6R. The yellow box indicates 1 bp insertion on exon 14 of Golden queen 3.
Fig. 5 PCR band patterns to confirm waxy traits. The used markers are Indel marker (Ex2-23) and CAPS marker (Ex4-Wx-mq) to 10 materials. (A) Ex2-indel-23, (B) Ex4-Wx-mq. Lane 1-2, Non-glutinous rice (Ilpum, Jungsaenggold); Lane 3-4, Glutinous rice (Dongjinchal, Boseokchal); Lane 5-6, Low amylose rice (Baegjinju, Manmi); Lane 7-10, Low amylose rice of Wx-mq gene (Wolback, Jinsang, Jinsang 2, Golden queen 3); M: 100 bp ladder marker.
Golden queen 3: A High-quality Rice Variety with Low Amylose Contents and Aroma

The list of rice varieties for GBSS I genes analysis.

Variety Heading date Amylose content (%) Ex2-Indel-23 Ex4-Wx-mq Reference
Ilpum 8.14 18.9 - - Yoon et al. 2012
Jungsaenggold 8.08 17.2 - - Cho et al. 2013
Donjinchal 8.13 4.5 Duplication - Yoon et al. 2015
Boseokchal 8.16 5.5 Duplication - Yoon et al. 2015
Baegjinju 8.23 9.1 - - Hong et al. 2012
Manmi 8.16 12.9 - - Song et al. 2010
Wolbaek 7.31 11.6 - + Won et al. 2012
Jinsang 8.12 11.9 - + Hong et al. 2014
Jinsang 2 8.25 12.2 - + Lee et al. 2018
Golden queen 3 8.13 12.5 - + This study

The list of DNA markers for GBSS I gene analysis.

Marker Forward Reverse Restriction enzyme Reference
Ex2-Indel23 TGCAGAGATCTTCCACAGCA GCTGGTCGTCACGCTGAG - Samart et al. 2003
Ex4-Wx-mq TGTGGCTGAGGTAGGAGC AACGCATCTGGTTGTCTTTGT NlaIII Wang et al. 2010

Major agronomic traits and yield components.

Variety Heading date Culm length (cm) (n=30)z Panicle length (cm) (n=30) No. of panicles per hill (n=30) No. of spikelets per panicle (n=30) 1,000 grain (brown rice) weight (g) (n=30)
Golden queen 3 8/13 75.7±1.5** 20.1±1.2* 14.7±1.1ns 104.8±4.3** 21.80±0.27**
Hwayeong 8/11 77.8±2.1 19.5±1.2 14.1±1.6 97.3±3.4 21.40±0.25

Response to physiological stress and pest resistance.

Variety Lodging in field (0-9) Leaf senescence at maturity Cold tolerance Neck blast Bacterial blight Rice stripe virus Brown plant hopper
Golden queen 3 3 Slow Mz M M S S
Hwayeong 3 Slow M M R R S

Grain characteristics of ‘Golden queen 3’.

Variety Brown rice Dehulling recovery (Brown/Rough, %) Grain yield (MT/ha)
Length (mm) (n=30)z Width (mm) (n=30) Thickness (mm) (n=30) L/W ratio
Golden queen 3 4.97±0.10ns 2.96±0.10* 2.09±0.07** 1.68 78.5 5.47
Hwayeong 5.01±0.14 2.90±0.10 2.02±0.06 1.73 77.3 5.16

Physicochemical properties and eating quality of ‘Golden queen 3’.

Variety Translucency (1~9) White core/belly (0~9) Amylose content (brown rice, %) Protein content (brown rice, %) Glossiness of cooked ricez
Golden queen 3 4 - 12.5 6.9 79
Hwayeong 1 0/1 18.2 7.5 61

Fatty acids composition of ‘Golden queen 3’.

Variety Saturated fatty acid (SFA, %) Unsaturated fatty acid (USFA, %)
C14:0 C16:0 C18:0 Total C18:1 C18:2 C18:3 Total
Golden queen 3 0.7 24.1 1.9 26.7 33.4 38.6 1.3 73.3
Hwayeong 0.7 24.7 2.1 27.5 32.2 39.1 1.2 72.5
Table 1 The list of rice varieties for GBSS I genes analysis.
Table 2 The list of DNA markers for GBSS I gene analysis.
Table 3 Major agronomic traits and yield components.

zNo. of plants evaluated, * and ** indicate significance at 0.05 and 0.01 levels, respectively. ns: No significant.

Table 4 Response to physiological stress and pest resistance.

zR: Resistant, M: Moderate, S: Susceptible

Table 5 Grain characteristics of ‘Golden queen 3’.

zNo. of plants evaluated, * and ** indicate significance at 0.05 and 0.01 levels, respectively. nsNo significant.

Table 6 Physicochemical properties and eating quality of ‘Golden queen 3’.

zGlossiness of cooked rice was measured by Toyo mito-meter

Table 7 Fatty acids composition of ‘Golden queen 3’.