국립원예특작과학원 사과연구소
Apple Research Institute, National Institute of Horticultural and Herbal Science, RDA, Gunwi 39000, Republic of Korea JFIF d d Ducky d qhttp://ns.adobe.com/xap/1.0/ |er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE &ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ >=F)2[nk؆?훐 M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag% qkEUzUgæBhߕP(7]kFnq?֖Cpru Z6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p \̅S?㭻;t~ R߁ )^/>Qj`yt[w ԛ;² ~+ ߔ_ YW~|o] ?x^ᯛ `ʼn;g)T@vWn]>&4l p+$D̢1l|ȨF%-} .9[}w~
ԠLM9hСablfe&QoW !s ?wjLK?s7yO>(=C~_nyǜu? v 3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw= /7ovuk+\V;lDgն <[A+r X~d;m!_s8ݖ;;.0llUC+?i#_crʙ1~C.\q u l8Hܶ2m`ܻM3Tov|Bs rɵ"oLS-
DКw=Tv@f '6|YlD͓Y%-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~
&f#
}o!muH; ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{
m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ
dng>ەZ,Mmϑ :n6nϦezW qUJ4! ۇ4R! =>>F n|Q[{pRO 17ƕ~._I ''00k=b՛o}Osðc2'o\3}ݭQ^ 2 . R1yKȣtAݿ-u ܾw!`?1Whn|gzU o[ECWwjUIן)^h#1ɭ!/Z
np;o;ΗŻkXs."6E`Z1
עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV 2`y/0E˛6+ԫ1?
6}KW c\KoKͨ2ۅFws*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* P RaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ
^˒4kƓmzDx
\
'Nq amP7nyN݅=
Copyright © 2020 by the Korean Society of Breeding Science
This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
| Primers | Sequence (5'→3') |
Amplicon size (bp) |
Annealing Temp. (℃) |
Reference | |
| Md-ACS1 |
ACS1-F ACS1-R |
CTCCTCCTTTCCTTCGTTGA ACCATGTCGTCGTTGGAGTAG |
2 : 655, 1 : 489 | 58 | Sunako et al. (1999) |
| Md-ACO1 |
ACO1-F ACO1-R |
ATCAATGATGCTTGTGAGAACTG GGTCTTCTTGTAGTGATCCTTGG |
2 : 587, 1 : 525 | 65 | Costa et al. (2005) |
| Md-PG1SSR10kd |
PG1-F PG1-R |
TTTCTTCCTTGGGTTTTTGG ACTCGTGCGCCAGATAGC |
3 : 298, 2 : 291, 1 : 288 | 56 | Longhi et al. (2013) |
| Genotypez | Cultivar or collection namey | ||
|---|---|---|---|
|
|
|||
| ACS1 | ACO1 | PG1 | |
| 1/1 | 1/1 | 1/1 | Almey, Annurca, Dorothea, Gorgeous, Roberts Crab, SI-22-40 |
| 1/1 | 1/1 | 1/3 | 67PRI 1279-9 (27-55) |
| 1/1 | 1/1 | 2/2 | Adam’s Crab, Ashiro 3, Indian Summer Crab, Malus koreara, Malus sikkimensis Koehn, Red Jade, Robinson Crab |
| 1/1 | 1/1 | 3/3 | Akita Tare, Oswego, Snowdrift, Suislepper |
| 1/1 | 1/2 | 1/1 | Aegisagwa, Akita Maruba Tachi, Crimson King, Eley Purple Crab, FO73.11D.3, Hopa Crab A, Hopa Crab B, Malus prunifolia Fastigiata, Malus prunifolia var. macrocar, Malus robusta Baily, Malus robusta var. eleta 88075, Malus sylvestris Plena, Megumi x Jonathan, Morioka 55, Noret, Pink Beauty, Profusion, Purple Wave, Robusta 5, Tartan, Tohoku #4, Wakapingguo, Winter Gold Crab |
| 1/1 | 1/2 | 1/3 | Blaxstayman, Butter Ball, Collet, Columbia, Cowichan, De Jaune, Derman Winesap (4X), DIR68T492, Eosocheonwon, Hoehwa, Isawevis, Jonagram, M. gloriosa, Noiphing, Parker’s Pippin, Salute, Schoner aus Itzstedt, Tawria, Terry, Trusevitch Ⅰ-48-41, Verginia Crab K6, Wellington, White Pippin, Youyi |
| 1/1 | 1/2 | 2/2 | Adams’s Pearmain, Crimson Glory, Malus sargentii Rosea, Midget crab, Nagasaki Zumi, Pink Perfection, Prinicia, Sentinel Crab, St. Edmund’s Russet |
| 1/1 | 1/2 | 2/3 | Chulanka, Collins June, Court Pendu, Court Pendude France, CourtPenduPlat, Crawley Beauty, Dab325, Humboldt, Landsberger Reinette, M.platycarpa IRA 38-1, Malabols, Malus prunifolia DE 229, Max Trio, Reinette Clochard, Reinette du Canada, Shandongpingguo, Trial Ornamental, Urawa Tare, Whitney, Yeikan |
| 1/1 | 1/2 | 3/3 | Baxter, Chehalis, Early Joe, Early Strawberry, Malus columnaris, Malus Darth Mounta, Noiprim, Nova Easygro, Red June, Reid’s Seedling, Summer Champion, Whitney Crab |
| 1/1 | 2/2 | 1/1 | Anhaeng Tare, Arnold Crab, Atlas (UZ-84), Belle Fleur Large Mouche, Bessemyanka Michurina, Charlamoff, Demir, Doch Diany, Foxwhelp, Harcourt, Hatsubenishibori, Kemp, Keuleman, Malus laurifolia, Malus prunifolia Sikora, Malus pumila Royalty, Malus turesii, Merton Beauty, Nishtani Jonathan, Novosibirski Sweet, Paides Ziemas Abols, Roter Eiserapfel, Royale d’Angleterre, Samar Candskoe rannee, Scheidecker Crab, Stark Earliest, Succary, Virginiagold, Yeondaejohongha |
| 1/1 | 2/2 | 1/2 | Drap D’or Guemene, Primus |
| 1/1 | 2/2 | 1/3 | Alton, Ananas Rouge, Antonovka Karmen, Aromatic Russet, Arthur Turner, Battleford, Beatrix, Bellefleur Record, Beninomai, Blenheim Orange, Blenheim Pippin, BrabantBellefleur, Caravel (=Portia), Crow Egg, De Flanders, Democrat, Dubbele Zoete Aagt, Egremont, Frostproof, Greeveston Fanny, Gros Bois, Gros Frequin, Guldborg, Hibernal, Hwado, Lady (Lady Apple, Api), Lixiang, Macfree, Nubeena, Olga Crab, Orleans Reinette, P.18, Pederstrup, Pingguo, Pink Wood, Poeltsamaa Winter Apple, Pomme Royale, Prince Nicolas, Prinzen Apfel, Purpurroter Cousinot, Quastresse, R12740, Severny Sinap K-21, 39, Spasovka Kvasna, Spy 227, Summer Rose, Sylvia, Trent, Uralian Butter, Van Eseltine, York Imperial, Young America, Youyiaben, Zaohwang, Zhongqiu |
| 1/1 | 2/2 | 2/2 | Antonovka, Antonovka Shafran, Belle Fille, Budagovsky 57-491, Hillieri, Michelin, Spur Lodi, Stark Primo, Xinshuai |
| 1/1 | 2/2 | 2/3 | Altaiski Sweet, Bongli, Carmine Crab 81108 HT, Cestra Belferkitaika, Crimson Superb, Earl, Flontish, Gross Bohn, Gwendolyn, Huidobro, HunterOttawa244 4×, Ikorrocavka Alaja, James Grieve (Red Rosamund Strain), Kuoteshaho, Lalla Red Delicious (T1-27-77), Lemoine Purple Crab, Local 6 (907579), M. robusta Joan, M. soulardii, Major, Malus jacki, Malus zumi, Menkoi Hime, Mislimka, Muscadet de Dieppe, NO pip, Norfolk Royal, Norhey, Northwood, Ogden, PK-14, PRI 77-1, Reinerre d’espagne, Repinvaldo de Liebana, Roda Mantet, Rozovoye Priewoskhodnoye, Sensacion, Steacy, Yukari |
| 1/1 | 2/2 | 3/3 | A 2, Alpha 68, Alpha 68A, Anisim, Anoka, Appa No. 3, Arkansas Black, Aromat de vara, Athabasca, Beautiful Arcade, BernerRosen, Beverly Hills, Bolero, Britemac, Carroll, CG 10, Chouyou, Chunhyang, Cortland, Court Royal, Crollon, Dayton, Derman McIntosh (4X), Desertnoe Petrove, Doux Normandie, Doux-AMR, E559-13, Earliblaze, Early Golden, Field Spy, Flaym, FlowerofKent, Frequin, Geneva Early, Gingergold, Gloria Mundi, Grenadier, Hall Keeper, Improved McIntosh, Ingol, Jabchenab, Jadernicka, Jajang, Jamba, Kestrel, King of Tompkins 2, Kitanosachi, Klarapfel, Laxton’s Superb, Liestnaya Antonoffku #1836-A, Local 2 (907575), Local 4 (907577), Local 5 (907578), Loyda, M.1, M.3, M.5, M.7 EMLA, Malus pumila Apetala, Manitoba Spy, Marin Onfroy, Marshall McIntosh, Maypole, McIntosh Spur, McIntosh Summerland Red, Merton 793, Merton Ace, Merton Worcester, Milton, MM.102, MM.103, MM.104, MM.115, Nico, Northern Spy, Obilnoye, Ottawa 1, Ottawa 3, Ottawa 8, P.13, P.14, Pajam 1, Papirovkapolska, Parkland, Patricia, PRI 333-9, Primate, Prime Golden, Puritan, Red Apple, Red Canel, Red Dijmanszoet, Redfree, Reinette de Champagne, Reinette De Cuzy, Reinette van Ekenstein, Rosemary Russet, Rossoshanskoje Polosatoje, Schoharie Spy, Shaphran Letnij, Shenandoah, Shuihongsepingguo, Sops of wine, Spencer Seedlss, Spur Red Delicious, Spur Starking, Stayma Keel, Stearns, Sterappel, Striped Tawny, Suislepas Rozabols, Susvorenskoye #4, Szapanska, Thurgauer Weinapfel, Tohoku #2, Tuscan, Vandevere B-26-4, Wabskaw, Wayne, Wellington Bloomless, Williams Favourite, Yellow Bellflower, Yellow Siberian |
| 1/2 | 1/1 | 1/1 | Fukutami, Jeongseonmaeju, Schlect Spur Red Delicious, Zhigulevskoe |
| 1/2 | 1/1 | 1/2 | Early Stripe Spur |
| 1/2 | 1/1 | 1/3 | Ben Spur, Bisbee Spur, Brigham Delicious, Chellan Red, Red Delicious, Delicious, Derman Delicious (4X), Double Red Delicious, Fruitland Delicious, Imperial Red Delicious, Jonadee, Kinrei, Miller Sturdy Spur, Shiro, Short Well, Sky Spur, Stahls Prinz, Starkspur Delicious, Strip Bisbee, Wayne Spur Delicious |
| 1/2 | 1/1 | 3/3 | Mu-Jon, Nero Rome, Ryan, White Winter, White Winter Pearmain, Wickson |
| 1/2 | 1/2 | 1/1 | Akane, Bel Golden, Boller McIntosh, Chestnut Crab, Eikou, Ellison Orange, Kiou, Michinoku, Nero-26, Prairie Spy, Royal Jonathan, Staymared, Stembridge Cluster, Sundale Sturdee Spur, Tsugaru-Sayaka, Wealthy Double Red Delicious |
| 1/2 | 1/2 | 1/2 | Stark Florence |
| 1/2 | 1/2 | 1/3 | Alps Otome, Antonovka Zheltaia, Arlet, Bhrens, Bramley’s Seedling, Captain Kidd, Conrad, Cut, Delistein, Eurika, Great Ralls, Hillwell Red Braeburn, Hunter Sandow 2-4-4, Idared-1, Idared-2, Ivette, Moira, Newfane, Oilase, Priscilla, Red Cinnamon, Subtropical Apple, Sun Gold, Sweet Delicious, Tilsith, Trusevitch V-5-38, Turley Winesap, Yantaishaguo |
| 1/2 | 1/2 | 2/2 | Early Banta, Hwangtaepyeong, Inducoa No.1, Longguan, Minisker von Hammerstein, Yellow Newtown, Yesansamyeob |
| 1/2 | 1/2 | 2/3 | Berlepsch Red, Chinatsu, Giant Janet, Improved Lambrook Pippin, Kile, Korei, Lord Wolsley, Loyalist, Northern Lights, Rozovoe, Sheisyun, Shizuka, Swiss Gourmet |
| 1/2 | 1/2 | 3/3 | Amelia, Empire, Franklin, Jersey Spur, King Edward Ⅶ, Malus coronaria Wynema, Mantuanskoye, NFT 1, Orin, Pitsmaston Pineapple x 692, Red Fortune, Sudeten Reinette, Sunlight, Tropical Beauty, Webster, York-A-Red |
| 1/2 | 2/2 | 1/1 | Aroma, Baumann’s Reinette, Beauty Tsugaru, Bedford Pippin, Bercon, Blue Pearmain, Carola, De Roche st lawrence, De Roche st. Lawrence, Early Red Rich, Emneth Earlry, Florina, Frian Dise, Kem Tsugaru, Natsuka Tsugaru, Pink Lady, Spur Earliblaze, St. Cecilia, Sturmer Pippin, Tsugaru, Tsugaru-Hime, William s Pride, Yamamo Tsugaru |
| 1/2 | 2/2 | 1/3 | Alfa, Amere, Amere de Berthecourt (True), Aori No.1, Bedfordshir Foundling, Berthecourt, Beverly Crab, Bulmer Norman, Burgundy, Cherry cox, Chuxiao, Coast Apple, Cox’s Orange Pippin, Cox’s Orange pippin Self-fortile clone4, Delago, Devonshire Quarreden, DL-11-12, Dutch Mignonne, Eickhoff, Eikan, Empress, Fallwater, Fantazja, Fuhong, Geneva Black, Gladstone, Golden Grecoce, Gravenstein, Greenball, Hausmar, Jonagored, Jonica, Karmijn, Local 10 (907583), Local 11 (907584), Lombart’s Calville, Longfield, Malus rockii, McIntosh, Nepal, Nugget Spur, NY 674, Potomac, Potter, Red Melba, Shinkou, Tsugaru-Hayate, Zuccalmaglio |
| 1/2 | 2/2 | 2/2 | Hongso, Lady Williams, Martini VH/430, Merton Pearmain, Spuree Rome, Stembridge Jersey, Vandevere |
| 1/2 | 2/2 | 2/3 | Blairmont, Blushing Gold, Chautauqua, Doud Golden Delicious (4X), Doyle, Early Harvest, Gold Spur, Golden Delicious, Malus mandshurica 2330, Mutsu, Odin, Peck’s Pleasant, Pepin Shafrannyi, Pigeonnet, Regent, Reinette Grise, Rugenthaons, Smoothee Golden, Smordodina, Spigold, Spur Golden Delicious, Summer Dream, Sunrise, Tale Sweet, Telamon, Wolf River, Yellow Delicious |
| 1/2 | 2/2 | 3/3 | Aizaohui, Alkmene, Anna, Aurora, Baldwin, Bancroft, Beforest, Brusnichoe, Calville Blanc, Charlotte, Chesapeak Apple, Chicheng, Clarke, Crandall, Diana, Esopus Spitzenburg, Fillbarrel, Gallia Beauty, Glockenapfel, Goro, Granny Smith, Greensleeves, Heyer #12, Hongsim, Indo, Ingram, Jonagold,Rubinstar, Lord Lambourne, M255-0010, Mahe-7, Manshu, Michaelmas Red, Mollie’s Delicious, Monmouth Beauty, Morden 359, Mother, Muscadet de Lense, OBIR2T47, Ontario, Oregon Spur, Oriole, Ortley, Ottawa, Oyusanjeong, Piervomaiskoie, Pink Pearl, Pixie, Pomme Cloche, PRI 2050-2, Priam, Radoux, Ranger, Red Astrachan, Red coy’s Pomona, Redstreak, Rhode Island Greening, SA54-43, Sampion, Scarlet Sentinel M.11 apple, Shin Indo, Sir Prize, Smokehouse, Spencer, Stafford, Stoke Red, Summerred, Sunburn, Sweet Alford, Sweet Coppin, Sweet McIntosh, Tallmans Sweet, Tumanga, VIP, Winesap, Winter Banana, Yuggyehaedang, Zaohui, Zigeunerinapfel, Zuboff |
| 2/2 | 1/1 | 1/1 | Chubu, E36-7, Fuji, Fuji-Benishogun, Fuji-Champion, Fuji-Hangawi, Fuji-Jubilee, Fuji-KIKU 8, Fuji-Myra Red, Fuji-Nagafu 12, Fuji-Nagafu 2, Fuji-Nagafu 6, Narita Fuji, Fuji-Rakuraku, Yamadani 2gei Fuji, Fuji-Akifu-1, Fuji-Royal, Fuji-Royal 21, Iwakami, Mimaki Spur, Spur Fuji, Standel, Sun Fuji, Wangsil, Yataka |
| 2/2 | 1/1 | 2/2 | Marie-Joseph d’Othee, Nyeongpung |
| 2/2 | 1/2 | 1/1 | Aori No.15, Dulcet (Bailey), Geumwangja, Holly, Honggeum, Hwangok, Idajon, Kagayaki, Nyeongsu, Pilot, Splendor |
| 2/2 | 1/2 | 1/3 | Annie Elizabeth, Dunkerton Late, Hwamugold, Kinsei, Picnic, Sandel |
| 2/2 | 1/2 | 2/2 | Hongan, Malus fusca F2, Miki Life, Mitsuyoshi, Shenshu |
| 2/2 | 1/2 | 2/3 | Gala-Regal, Gala-Scarlet, Sahmiga (G), Sosogwa, Topaz |
| 2/2 | 1/2 | 3/3 | 4814018, C. R. Fireside, Gala, Galaxy Gala, Gloster 69, Lakeland, Orei, Seohong, Shengli, Vystavochnoye, Yume Oirase, Yunqing, Gamhong |
| 2/2 | 2/2 | 1/1 | Akagi, Alome Mills, Liaofu, Opalescent, Shinano Gold, Undine |
| 2/2 | 2/2 | 1/3 | Bonnoe, Charles Ross, Discovery, Ingrid Marie, Reverend. W. Wilks, Spartan, State Fair, Vanda |
| 2/2 | 2/2 | 2/3 | Kandil Sinap, Lustre Elstar, Northwest Greening, Rumut |
| 2/2 | 2/2 | 3/3 | Belle de Jardins, Delbarestivale, Jewel, Meran, Resista, Willow Twig |
| Genotypez | Firmness (N) | ||
|---|---|---|---|
|
|
|||
| Fresh fruit | Storage fruit | Difference in fresh and storage fruit | |
| ACS1-1/1 | 71.6ay | 32.7b | 38.9a |
| ACS1-1/2 | 66.3a | 36.3b | 29.9a |
| ACS1-2/2 | 67.6a | 48.7a | 18.9b |
|
|
|||
| ACO1-1/1 | 66.5a | 41.2a | 25.3a |
| ACO1-1/2 | 66.5a | 41.8a | 24.8a |
| ACO1-2/2 | 69.1a | 34.6a | 34.5a |
|
|
|||
| PG1-1/1 | 69.0a | 50.5a | 18.6bc |
| PG1-2/2 | 62.9a | 48.2a | 14.8c |
| PG1-1/3 | 67.2a | 31.9a | 35.4a |
| PG1-2/3 | 67.8a | 36.3a | 31.5ab |
| PG1-3/3 | 68.9a | 34.1a | 34.9a |
Primer sequences used for amplifying Md-ACS1, Md-ACO1, and Md-PG1 genes.
| Primers | Sequence (5'→3') | Amplicon size (bp) |
Annealing Temp. (℃) |
Reference | |
| Md-ACS1 | ACS1-F ACS1-R |
CTCCTCCTTTCCTTCGTTGA ACCATGTCGTCGTTGGAGTAG |
2 : 655, 1 : 489 | 58 | |
| Md-ACO1 | ACO1-F ACO1-R |
ATCAATGATGCTTGTGAGAACTG GGTCTTCTTGTAGTGATCCTTGG |
2 : 587, 1 : 525 | 65 | |
| Md-PG1SSR10kd | PG1-F PG1-R |
TTTCTTCCTTGGGTTTTTGG ACTCGTGCGCCAGATAGC |
3 : 298, 2 : 291, 1 : 288 | 56 | |
Md-ACS1, Md-ACO1, and Md-PG1 genotype of 750 apple germplasm preserved in Apple Research Institute (Gunwi), NIHHS, RDA.
| Genotypez | Cultivar or collection namey | ||
|---|---|---|---|
| ACS1 | ACO1 | PG1 | |
| 1/1 | 1/1 | 1/1 | Almey, Annurca, Dorothea, Gorgeous, Roberts Crab, SI-22-40 |
| 1/1 | 1/1 | 1/3 | 67PRI 1279-9 (27-55) |
| 1/1 | 1/1 | 2/2 | Adam’s Crab, Ashiro 3, Indian Summer Crab, Malus koreara, Malus sikkimensis Koehn, Red Jade, Robinson Crab |
| 1/1 | 1/1 | 3/3 | Akita Tare, Oswego, Snowdrift, Suislepper |
| 1/1 | 1/2 | 1/1 | Aegisagwa, Akita Maruba Tachi, Crimson King, Eley Purple Crab, FO73.11D.3, Hopa Crab A, Hopa Crab B, Malus prunifolia Fastigiata, Malus prunifolia var. macrocar, Malus robusta Baily, Malus robusta var. eleta 88075, Malus sylvestris Plena, Megumi x Jonathan, Morioka 55, Noret, Pink Beauty, Profusion, Purple Wave, Robusta 5, Tartan, Tohoku #4, Wakapingguo, Winter Gold Crab |
| 1/1 | 1/2 | 1/3 | Blaxstayman, Butter Ball, Collet, Columbia, Cowichan, De Jaune, Derman Winesap (4X), DIR68T492, Eosocheonwon, Hoehwa, Isawevis, Jonagram, M. gloriosa, Noiphing, Parker’s Pippin, Salute, Schoner aus Itzstedt, Tawria, Terry, Trusevitch Ⅰ-48-41, Verginia Crab K6, Wellington, White Pippin, Youyi |
| 1/1 | 1/2 | 2/2 | Adams’s Pearmain, Crimson Glory, Malus sargentii Rosea, Midget crab, Nagasaki Zumi, Pink Perfection, Prinicia, Sentinel Crab, St. Edmund’s Russet |
| 1/1 | 1/2 | 2/3 | Chulanka, Collins June, Court Pendu, Court Pendude France, CourtPenduPlat, Crawley Beauty, Dab325, Humboldt, Landsberger Reinette, M.platycarpa IRA 38-1, Malabols, Malus prunifolia DE 229, Max Trio, Reinette Clochard, Reinette du Canada, Shandongpingguo, Trial Ornamental, Urawa Tare, Whitney, Yeikan |
| 1/1 | 1/2 | 3/3 | Baxter, Chehalis, Early Joe, Early Strawberry, Malus columnaris, Malus Darth Mounta, Noiprim, Nova Easygro, Red June, Reid’s Seedling, Summer Champion, Whitney Crab |
| 1/1 | 2/2 | 1/1 | Anhaeng Tare, Arnold Crab, Atlas (UZ-84), Belle Fleur Large Mouche, Bessemyanka Michurina, Charlamoff, Demir, Doch Diany, Foxwhelp, Harcourt, Hatsubenishibori, Kemp, Keuleman, Malus laurifolia, Malus prunifolia Sikora, Malus pumila Royalty, Malus turesii, Merton Beauty, Nishtani Jonathan, Novosibirski Sweet, Paides Ziemas Abols, Roter Eiserapfel, Royale d’Angleterre, Samar Candskoe rannee, Scheidecker Crab, Stark Earliest, Succary, Virginiagold, Yeondaejohongha |
| 1/1 | 2/2 | 1/2 | Drap D’or Guemene, Primus |
| 1/1 | 2/2 | 1/3 | Alton, Ananas Rouge, Antonovka Karmen, Aromatic Russet, Arthur Turner, Battleford, Beatrix, Bellefleur Record, Beninomai, Blenheim Orange, Blenheim Pippin, BrabantBellefleur, Caravel (=Portia), Crow Egg, De Flanders, Democrat, Dubbele Zoete Aagt, Egremont, Frostproof, Greeveston Fanny, Gros Bois, Gros Frequin, Guldborg, Hibernal, Hwado, Lady (Lady Apple, Api), Lixiang, Macfree, Nubeena, Olga Crab, Orleans Reinette, P.18, Pederstrup, Pingguo, Pink Wood, Poeltsamaa Winter Apple, Pomme Royale, Prince Nicolas, Prinzen Apfel, Purpurroter Cousinot, Quastresse, R12740, Severny Sinap K-21, 39, Spasovka Kvasna, Spy 227, Summer Rose, Sylvia, Trent, Uralian Butter, Van Eseltine, York Imperial, Young America, Youyiaben, Zaohwang, Zhongqiu |
| 1/1 | 2/2 | 2/2 | Antonovka, Antonovka Shafran, Belle Fille, Budagovsky 57-491, Hillieri, Michelin, Spur Lodi, Stark Primo, Xinshuai |
| 1/1 | 2/2 | 2/3 | Altaiski Sweet, Bongli, Carmine Crab 81108 HT, Cestra Belferkitaika, Crimson Superb, Earl, Flontish, Gross Bohn, Gwendolyn, Huidobro, HunterOttawa244 4×, Ikorrocavka Alaja, James Grieve (Red Rosamund Strain), Kuoteshaho, Lalla Red Delicious (T1-27-77), Lemoine Purple Crab, Local 6 (907579), M. robusta Joan, M. soulardii, Major, Malus jacki, Malus zumi, Menkoi Hime, Mislimka, Muscadet de Dieppe, NO pip, Norfolk Royal, Norhey, Northwood, Ogden, PK-14, PRI 77-1, Reinerre d’espagne, Repinvaldo de Liebana, Roda Mantet, Rozovoye Priewoskhodnoye, Sensacion, Steacy, Yukari |
| 1/1 | 2/2 | 3/3 | A 2, Alpha 68, Alpha 68A, Anisim, Anoka, Appa No. 3, Arkansas Black, Aromat de vara, Athabasca, Beautiful Arcade, BernerRosen, Beverly Hills, Bolero, Britemac, Carroll, CG 10, Chouyou, Chunhyang, Cortland, Court Royal, Crollon, Dayton, Derman McIntosh (4X), Desertnoe Petrove, Doux Normandie, Doux-AMR, E559-13, Earliblaze, Early Golden, Field Spy, Flaym, FlowerofKent, Frequin, Geneva Early, Gingergold, Gloria Mundi, Grenadier, Hall Keeper, Improved McIntosh, Ingol, Jabchenab, Jadernicka, Jajang, Jamba, Kestrel, King of Tompkins 2, Kitanosachi, Klarapfel, Laxton’s Superb, Liestnaya Antonoffku #1836-A, Local 2 (907575), Local 4 (907577), Local 5 (907578), Loyda, M.1, M.3, M.5, M.7 EMLA, Malus pumila Apetala, Manitoba Spy, Marin Onfroy, Marshall McIntosh, Maypole, McIntosh Spur, McIntosh Summerland Red, Merton 793, Merton Ace, Merton Worcester, Milton, MM.102, MM.103, MM.104, MM.115, Nico, Northern Spy, Obilnoye, Ottawa 1, Ottawa 3, Ottawa 8, P.13, P.14, Pajam 1, Papirovkapolska, Parkland, Patricia, PRI 333-9, Primate, Prime Golden, Puritan, Red Apple, Red Canel, Red Dijmanszoet, Redfree, Reinette de Champagne, Reinette De Cuzy, Reinette van Ekenstein, Rosemary Russet, Rossoshanskoje Polosatoje, Schoharie Spy, Shaphran Letnij, Shenandoah, Shuihongsepingguo, Sops of wine, Spencer Seedlss, Spur Red Delicious, Spur Starking, Stayma Keel, Stearns, Sterappel, Striped Tawny, Suislepas Rozabols, Susvorenskoye #4, Szapanska, Thurgauer Weinapfel, Tohoku #2, Tuscan, Vandevere B-26-4, Wabskaw, Wayne, Wellington Bloomless, Williams Favourite, Yellow Bellflower, Yellow Siberian |
| 1/2 | 1/1 | 1/1 | Fukutami, Jeongseonmaeju, Schlect Spur Red Delicious, Zhigulevskoe |
| 1/2 | 1/1 | 1/2 | Early Stripe Spur |
| 1/2 | 1/1 | 1/3 | Ben Spur, Bisbee Spur, Brigham Delicious, Chellan Red, Red Delicious, Delicious, Derman Delicious (4X), Double Red Delicious, Fruitland Delicious, Imperial Red Delicious, Jonadee, Kinrei, Miller Sturdy Spur, Shiro, Short Well, Sky Spur, Stahls Prinz, Starkspur Delicious, Strip Bisbee, Wayne Spur Delicious |
| 1/2 | 1/1 | 3/3 | Mu-Jon, Nero Rome, Ryan, White Winter, White Winter Pearmain, Wickson |
| 1/2 | 1/2 | 1/1 | Akane, Bel Golden, Boller McIntosh, Chestnut Crab, Eikou, Ellison Orange, Kiou, Michinoku, Nero-26, Prairie Spy, Royal Jonathan, Staymared, Stembridge Cluster, Sundale Sturdee Spur, Tsugaru-Sayaka, Wealthy Double Red Delicious |
| 1/2 | 1/2 | 1/2 | Stark Florence |
| 1/2 | 1/2 | 1/3 | Alps Otome, Antonovka Zheltaia, Arlet, Bhrens, Bramley’s Seedling, Captain Kidd, Conrad, Cut, Delistein, Eurika, Great Ralls, Hillwell Red Braeburn, Hunter Sandow 2-4-4, Idared-1, Idared-2, Ivette, Moira, Newfane, Oilase, Priscilla, Red Cinnamon, Subtropical Apple, Sun Gold, Sweet Delicious, Tilsith, Trusevitch V-5-38, Turley Winesap, Yantaishaguo |
| 1/2 | 1/2 | 2/2 | Early Banta, Hwangtaepyeong, Inducoa No.1, Longguan, Minisker von Hammerstein, Yellow Newtown, Yesansamyeob |
| 1/2 | 1/2 | 2/3 | Berlepsch Red, Chinatsu, Giant Janet, Improved Lambrook Pippin, Kile, Korei, Lord Wolsley, Loyalist, Northern Lights, Rozovoe, Sheisyun, Shizuka, Swiss Gourmet |
| 1/2 | 1/2 | 3/3 | Amelia, Empire, Franklin, Jersey Spur, King Edward Ⅶ, Malus coronaria Wynema, Mantuanskoye, NFT 1, Orin, Pitsmaston Pineapple x 692, Red Fortune, Sudeten Reinette, Sunlight, Tropical Beauty, Webster, York-A-Red |
| 1/2 | 2/2 | 1/1 | Aroma, Baumann’s Reinette, Beauty Tsugaru, Bedford Pippin, Bercon, Blue Pearmain, Carola, De Roche st lawrence, De Roche st. Lawrence, Early Red Rich, Emneth Earlry, Florina, Frian Dise, Kem Tsugaru, Natsuka Tsugaru, Pink Lady, Spur Earliblaze, St. Cecilia, Sturmer Pippin, Tsugaru, Tsugaru-Hime, William s Pride, Yamamo Tsugaru |
| 1/2 | 2/2 | 1/3 | Alfa, Amere, Amere de Berthecourt (True), Aori No.1, Bedfordshir Foundling, Berthecourt, Beverly Crab, Bulmer Norman, Burgundy, Cherry cox, Chuxiao, Coast Apple, Cox’s Orange Pippin, Cox’s Orange pippin Self-fortile clone4, Delago, Devonshire Quarreden, DL-11-12, Dutch Mignonne, Eickhoff, Eikan, Empress, Fallwater, Fantazja, Fuhong, Geneva Black, Gladstone, Golden Grecoce, Gravenstein, Greenball, Hausmar, Jonagored, Jonica, Karmijn, Local 10 (907583), Local 11 (907584), Lombart’s Calville, Longfield, Malus rockii, McIntosh, Nepal, Nugget Spur, NY 674, Potomac, Potter, Red Melba, Shinkou, Tsugaru-Hayate, Zuccalmaglio |
| 1/2 | 2/2 | 2/2 | Hongso, Lady Williams, Martini VH/430, Merton Pearmain, Spuree Rome, Stembridge Jersey, Vandevere |
| 1/2 | 2/2 | 2/3 | Blairmont, Blushing Gold, Chautauqua, Doud Golden Delicious (4X), Doyle, Early Harvest, Gold Spur, Golden Delicious, Malus mandshurica 2330, Mutsu, Odin, Peck’s Pleasant, Pepin Shafrannyi, Pigeonnet, Regent, Reinette Grise, Rugenthaons, Smoothee Golden, Smordodina, Spigold, Spur Golden Delicious, Summer Dream, Sunrise, Tale Sweet, Telamon, Wolf River, Yellow Delicious |
| 1/2 | 2/2 | 3/3 | Aizaohui, Alkmene, Anna, Aurora, Baldwin, Bancroft, Beforest, Brusnichoe, Calville Blanc, Charlotte, Chesapeak Apple, Chicheng, Clarke, Crandall, Diana, Esopus Spitzenburg, Fillbarrel, Gallia Beauty, Glockenapfel, Goro, Granny Smith, Greensleeves, Heyer #12, Hongsim, Indo, Ingram, Jonagold,Rubinstar, Lord Lambourne, M255-0010, Mahe-7, Manshu, Michaelmas Red, Mollie’s Delicious, Monmouth Beauty, Morden 359, Mother, Muscadet de Lense, OBIR2T47, Ontario, Oregon Spur, Oriole, Ortley, Ottawa, Oyusanjeong, Piervomaiskoie, Pink Pearl, Pixie, Pomme Cloche, PRI 2050-2, Priam, Radoux, Ranger, Red Astrachan, Red coy’s Pomona, Redstreak, Rhode Island Greening, SA54-43, Sampion, Scarlet Sentinel M.11 apple, Shin Indo, Sir Prize, Smokehouse, Spencer, Stafford, Stoke Red, Summerred, Sunburn, Sweet Alford, Sweet Coppin, Sweet McIntosh, Tallmans Sweet, Tumanga, VIP, Winesap, Winter Banana, Yuggyehaedang, Zaohui, Zigeunerinapfel, Zuboff |
| 2/2 | 1/1 | 1/1 | Chubu, E36-7, Fuji, Fuji-Benishogun, Fuji-Champion, Fuji-Hangawi, Fuji-Jubilee, Fuji-KIKU 8, Fuji-Myra Red, Fuji-Nagafu 12, Fuji-Nagafu 2, Fuji-Nagafu 6, Narita Fuji, Fuji-Rakuraku, Yamadani 2gei Fuji, Fuji-Akifu-1, Fuji-Royal, Fuji-Royal 21, Iwakami, Mimaki Spur, Spur Fuji, Standel, Sun Fuji, Wangsil, Yataka |
| 2/2 | 1/1 | 2/2 | Marie-Joseph d’Othee, Nyeongpung |
| 2/2 | 1/2 | 1/1 | Aori No.15, Dulcet (Bailey), Geumwangja, Holly, Honggeum, Hwangok, Idajon, Kagayaki, Nyeongsu, Pilot, Splendor |
| 2/2 | 1/2 | 1/3 | Annie Elizabeth, Dunkerton Late, Hwamugold, Kinsei, Picnic, Sandel |
| 2/2 | 1/2 | 2/2 | Hongan, Malus fusca F2, Miki Life, Mitsuyoshi, Shenshu |
| 2/2 | 1/2 | 2/3 | Gala-Regal, Gala-Scarlet, Sahmiga (G), Sosogwa, Topaz |
| 2/2 | 1/2 | 3/3 | 4814018, C. R. Fireside, Gala, Galaxy Gala, Gloster 69, Lakeland, Orei, Seohong, Shengli, Vystavochnoye, Yume Oirase, Yunqing, Gamhong |
| 2/2 | 2/2 | 1/1 | Akagi, Alome Mills, Liaofu, Opalescent, Shinano Gold, Undine |
| 2/2 | 2/2 | 1/3 | Bonnoe, Charles Ross, Discovery, Ingrid Marie, Reverend. W. Wilks, Spartan, State Fair, Vanda |
| 2/2 | 2/2 | 2/3 | Kandil Sinap, Lustre Elstar, Northwest Greening, Rumut |
| 2/2 | 2/2 | 3/3 | Belle de Jardins, Delbarestivale, Jewel, Meran, Resista, Willow Twig |
Fresh fruit firmness at harvest, firmness after 20 days of room temperature (20~25℃) storage and difference between firmness at harvest and firmness after storage in 108 samples.
| Cultivar or collection | Harvest date | Firmness (N) | Cultivar or collection | Harvest date | Firmness (N) | ||||
|---|---|---|---|---|---|---|---|---|---|
| Fresh fruit | Storage fruit | Difference | Fresh fruit | Storage fruit | Difference | ||||
| 4814018 | 10-Sep | 72.4 | 51.4 | 21.0 | Iwakami | 21-Aug | 67.7 | 46.3 | 21.4 |
| Akane | 10-Aug | 45.4 | 41.0 | 4.4 | Jadernicka | 20-Aug | 77.2 | 0.0 | 77.2 |
| Amere | 22-Aug | 77.4 | 0.0 | 77.4 | Kinrei | 3-Sep | 72.4 | 44.3 | 28.1 |
| Anna | 14-Aug | 32.1 | 0.0 | 32.1 | Kio | 14-Aug | 66.7 | 47.8 | 18.9 |
| Annurca | 6-Nov | 98.6 | 72.4 | 26.1 | Korei | 1-Oct | 60.0 | 39.5 | 20.5 |
| Antonovka shafran | 9-Aug | 50.2 | 27.1 | 23.2 | McIntosh | 30-Aug | 76.7 | 35.5 | 41.3 |
| Arkansas black | 29-Oct | 106.6 | 81.3 | 25.3 | Michelin | 30-Aug | 71.7 | 35.0 | 36.7 |
| Arlet | 11-Aug | 65.3 | 41.1 | 24.2 | Mollie`s Delicious | 14-Aug | 58.9 | 0.0 | 58.9 |
| Arthur Turner | 11-Aug | 59.7 | 33.4 | 26.3 | Mutsu | 3-Sep | 78.3 | 49.0 | 29.3 |
| Beforest | 3-Sep | 58.5 | 29.3 | 29.3 | Nero Rome | 30-Aug | 61.6 | 24.9 | 36.7 |
| Beninomai | 11-Aug | 79.4 | 0.0 | 79.4 | Nishtani Jonathan | 8-Aug | 35.0 | 0.0 | 35.0 |
| Beverly hills | 1-Aug | 44.9 | 30.7 | 14.2 | Northern Spy | 3-Sep | 98.8 | 50.7 | 48.0 |
| Blairmont | 1-Aug | 57.7 | 25.8 | 32.0 | Northwest Greening | 1-Oct | 96.7 | 78.5 | 18.3 |
| Blushing Gold | 3-Sep | 94.0 | 55.2 | 38.9 | Nubeena | 1-Nov | 106.3 | 94.4 | 11.9 |
| Bonnoe | 10-Sep | 69.9 | 45.8 | 24.1 | Nugget Spur | 1-Oct | 67.2 | 61.4 | 5.8 |
| Charles Ross | 13-Aug | 86.5 | 0.0 | 86.5 | Obilnoye | 30-Aug | 95.4 | 0.0 | 95.4 |
| Chicheng | 14-Sep | 55.3 | 52.7 | 2.6 | Oregon Spur | 6-Nov | 65.3 | 44.8 | 20.5 |
| Collet | 13-Aug | 56.0 | 0.0 | 56.0 | Orin | 3-Sep | 78.4 | 59.9 | 18.5 |
| Crimson King | 14-Aug | 74.6 | 0.0 | 74.6 | Oswego | 1-Oct | 90.5 | 52.4 | 38.1 |
| Dayton | 14-Aug | 61.8 | 44.9 | 16.9 | Pederstrup | 11-Sep | 67.7 | 0.0 | 67.7 |
| Delicious | 30-Aug | 58.9 | 27.9 | 31.0 | Picnic | 25-Sep | 69.7 | 36.2 | 33.5 |
| Demir | 17-Oct | 102.1 | 79.8 | 22.3 | Pink Lady | 9-Nov | 77.0 | 66.0 | 11.0 |
| Diana | 11-Oct | 69.3 | 38.8 | 30.4 | Pink Wood | 1-Aug | 59.9 | 21.8 | 38.0 |
| Double Red Delicious | 30-Aug | 66.3 | 38.5 | 27.8 | Pixie | 31-Aug | 111.0 | 74.9 | 36.2 |
| Early Golden | 2-Aug | 70.8 | 0.0 | 70.8 | Prairie Spy | 11-Sep | 81.5 | 52.9 | 28.6 |
| Eikou | 9-Aug | 53.4 | 48.1 | 5.3 | Red delicious | 3-Sep | 60.8 | 24.4 | 36.4 |
| Empress | 8-Aug | 53.4 | 0.0 | 53.4 | Royal Jonathan | 31-Aug | 75.8 | 44.9 | 30.9 |
| Eurika | 2-Aug | 51.9 | 0.0 | 51.9 | Sampion | 1-Oct | 59.7 | 24.2 | 35.5 |
| Fallwater | 1-Nov | 72.9 | 46.0 | 26.9 | Seohong | 9-Aug | 47.4 | 32.6 | 14.8 |
| Field Spy | 11-Sep | 64.2 | 49.8 | 14.4 | Shenshu | 3-Sep | 63.8 | 60.8 | 3.0 |
| FO73.11D.3 | 5-Nov | 86.9 | 63.6 | 23.3 | Shinano Gold | 17-Sep | 72.5 | 65.1 | 7.4 |
| Frequin | 14-Aug | 64.8 | 0.0 | 64.8 | Shiro | 3-Sep | 66.0 | 31.6 | 34.5 |
| Fuji | 31-Oct | 50.5 | 48.9 | 1.6 | Smokehouse | 20-Aug | 53.0 | 0.0 | 53.0 |
| Fuji-Nagafu 6 | 15-Oct | 57.9 | 56.7 | 1.2 | Smoothee Golden | 26-Sep | 62.9 | 33.0 | 29.9 |
| Fuji-Rakuraku | 15-Oct | 59.5 | 56.6 | 2.9 | Spartan | 31-Aug | 83.4 | 40.4 | 43.0 |
| Gala | 14-Aug | 80.2 | 55.1 | 25.1 | Spur Golden Delicious | 14-Sep | 59.6 | 41.5 | 18.1 |
| Galaxy Gala | 21-Aug | 77.5 | 57.1 | 20.4 | Spur Starking | 24-Aug | 62.9 | 37.1 | 25.9 |
| Gamhong | 2-Oct | 64.1 | 58.3 | 5.8 | Stearns | 13-Aug | 60.9 | 35.2 | 25.8 |
| Geneva Black | 14-Aug | 49.7 | 36.3 | 13.4 | Sun Gold | 20-Aug | 56.6 | 31.6 | 25.1 |
| Giant Janet | 6-Nov | 76.8 | 38.2 | 38.5 | Sundale Sturdee Spur | 14-Sep | 116.2 | 97.5 | 18.7 |
| Gingergold | 8-Aug | 44.4 | 0.0 | 44.4 | Sunlight | 14-Aug | 54.2 | 34.8 | 19.4 |
| Gold spur | 3-Sep | 76.8 | 42.8 | 34.0 | Sunrise | 1-Aug | 46.0 | 0.0 | 46.0 |
| Golden Delicious | 3-Sep | 63.5 | 42.9 | 20.5 | Sweet Delicious | 31-Aug | 65.3 | 37.8 | 27.5 |
| Gravenstein | 14-Aug | 46.9 | 0.0 | 46.9 | Tallmans Sweet | 31-Aug | 80.0 | 61.0 | 19.0 |
| Great Ralls | 6-Nov | 78.6 | 43.6 | 34.9 | Telamon | 27-Sep | 64.1 | 31.3 | 32.8 |
| Gros Bois | 20-Aug | 65.0 | 37.9 | 27.2 | Trent | 27-Sep | 89.3 | 74.7 | 14.5 |
| Hillwell Red Braeburn | 17-Oct | 66.6 | 33.7 | 32.9 | Tsugaru-Sayaka | 11-Aug | 61.8 | 39.2 | 22.6 |
| Holly 6-3 | 15-Oct | 56.5 | 43.2 | 13.3 | Turley Winesap | 17-Sep | 51.7 | 19.3 | 32.4 |
| Hongan | 27-Sep | 56.3 | 53.8 | 2.5 | Virginiagold | 1-Oct | 60.0 | 53.7 | 6.3 |
| Hongso | 14-Sep | 72.7 | 64.1 | 8.6 | White Winter Pearmain | 8-Nov | 60.7 | 26.4 | 34.3 |
| Hwangok | 14-Sep | 57.2 | 54.3 | 2.9 | Wickson | 8-Nov | 60.2 | 25.9 | 34.3 |
| Idajon | 17-Sep | 61.9 | 32.4 | 29.5 | Yellow Bellflower | 27-Sep | 75.3 | 37.0 | 38.4 |
| Idared-1 | 25-Sep | 62.8 | 45.2 | 17.6 | Yellow Delicious | 19-Sep | 62.8 | 42.7 | 20.1 |
| Ikorrocavka Alaja | 14-Aug | 38.0 | 0.0 | 38.0 | zuboff | 6-Sep | 94.5 | 20.8 | 73.8 |
According to genotype of Md-ACS1, Md-ACO1, and Md-PG1, fresh fruit firmness at harvest, firmness after 20 days of room temperature (20~25℃) storage, difference between firmness at harvest and firmness after storage in 108 samples.
| Genotypez | Firmness (N) | ||
|---|---|---|---|
| Fresh fruit | Storage fruit | Difference in fresh and storage fruit | |
| ACS1-1/1 | 71.6ay | 32.7b | 38.9a |
| ACS1-1/2 | 66.3a | 36.3b | 29.9a |
| ACS1-2/2 | 67.6a | 48.7a | 18.9b |
| ACO1-1/1 | 66.5a | 41.2a | 25.3a |
| ACO1-1/2 | 66.5a | 41.8a | 24.8a |
| ACO1-2/2 | 69.1a | 34.6a | 34.5a |
| PG1-1/1 | 69.0a | 50.5a | 18.6bc |
| PG1-2/2 | 62.9a | 48.2a | 14.8c |
| PG1-1/3 | 67.2a | 31.9a | 35.4a |
| PG1-2/3 | 67.8a | 36.3a | 31.5ab |
| PG1-3/3 | 68.9a | 34.1a | 34.9a |
zGenotype means the allelic composition of Md-ACS1, Md-ACO1, and Md-PG1 by PCR analysis.
yBold text indicate that cultivar or collection was used for firmness analysis.
zGenotype means the allelic composition of Md-ACS1, Md-ACO1, and Md-PG1 by PCR analysis.
yMeans followed by the same letters within the column per parameter are not significantly different (p<0.05).
