Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

동아시아 재래종 밀( L.) 유전자원의 고분자 글루테닌 조성과 숙기 특성 평가

Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period

Korean Journal of Breeding Science 2015;47(3):264-275.
Published online: August 31, 2015

National Agrobiodiversity Center, National Academy of Agricultural Science, RDA, Jeonju 560-500, Rep. of Korea

*Corresponding author (reset00@korea.kr, Tel: +82-63-238-4901, Fax: +82-63-238-4909)
• Received: August 10, 2015   • Revised: August 28, 2015   • Accepted: August 31, 2015

© Korean Society of Breeding Science All rights reserved

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 288 Views
  • 0 Download
  • 1 Crossref
prev next
  • This study is to raise the utilization of genetic resources of wheat (Triticum aestivum L.) landrace from East Asia (Korea, Japan, and China) by evaluating genetic variation related to end use quality concerned to bread making quality and early maturity, two very important characteristics of Korean wheat cropping system. To clarify the allelic variation of Glu-1 loci which decides HMW glutenin subunit composition, SDS-PAGE and DNA marker analysis were conducted by using 485 East Asian landrace wheat accessions in National Agrobiodiversity Center, RDA and NIAS genebank. And useful accessions getting full mark of glu-1 score and early maturity were selected to enhance the utilization of genetic resources to Korean wheat breeding.
    In this study, wheats from China showed the distinct characteristic. Whereas Glu-A1c (null) and Glu-B1b (7+8) allele are the most frequent in Korean and Japanese accessions, Glu-A1a (2*) and Glu-B1c (7*+9) are the most in Chinese accessions. When it comes to unique composition, Glu-B1f (13+16) and Glu-D1e (2+10) subunits are only in Chinese resources. Glu-B1d (6+8), Glu-B1e (20), Glu-D1b (7+8), and Glu-D1c (4+1) subunits are only in Korean resources. The accessions from China also has high PIC value (0.53) compared to ones from Korea (0.35) and Japan (0.35). Grouping by UPGMA analysis of combination of Glu-1 allele, most accessions from Korea and Japan are in the same group, but most Chinese ones were distinguished as the distinctive group. The evaluation of bread baking quality by Glu-1 scoring system, 26 accessions got full marks. Among them, 16 accessions from China were also matured before early June, suitable to Korean cropping system. Especially, 3 accessions (K151847, K151865, K151962) had very early maturity, matured in late May. These genetic resources, having good gluten composition and early maturity, are expected to widely be used for Korean wheat breeding.
재래종은 현대육종에 있어 유용형질들을 제공하는 중요한 자원이다. 특히 보통밀(Triticum aestivum)의 경우, 야생종 조 상이 명확하지 않아 재래종이 유일한 유전자풀로서 더욱 중 요하다(McFadden & Sears 1946, Kihara 1944). 반왜성 (Borlaug 1968), 병저항성(Rudd et al. 2001), 밀가루품질 (Nakamura et al. 2002) 등 다양한 특성들이 재래종으로부터 도입되었다. 쌀과 보리와는 달리, 70년대 이후 밀의 소비량은 꾸준히 증가해 2013년 기준 1인당 연간 소비량 쌀 67.2 kg, 밀 33.6 kg, 보리 1.3 kg로 명실공히 국내 제 2의 주곡작물로 성장했으나 국내 밀의 자급율은 1.1%에 불과한 수준으로 (MAFRA 2014) 재배기후조건이나 생산기반 등 대내외적으 로 비슷한 조건의 일본의 경우 밀자급율이 9~14%에 이르는 것과 크게 대조된다(Jin et al. 2011). 밀 자급율 향상에는 제 도적 뒷받침과 함께 다양한 용도별 지역별 맞춤형 우수 국산 밀 품종 육성이 중요하다. 2015년 기준으로 개발된 38종의 국산밀 품종 중 제빵용 품종으로는 조경밀이 유일하다. 재배 지의 한계성 등을 극복하고, 수요처가 요구하는 제빵적합 밀 공급을 보다 원활하게 하며, 다양한 제면용 밀과 함께 블렌딩 하여 우수한 품질의 국산밀가루를 생산해내기 위해서는 우수 한 제빵용 국산밀품종 육성이 시급하다. 이를 위해 다양한 유 전자원의 형질평가를 통해 우수한 육종재료와 그 정보를 육 종초기에 투입하여 효율을 높일 필요가 있다.
밀의 가공적성은 주로 저장단백질의 양적‧질적 특성에 의해 결정된다. 따라서 밀의 품질 개선은 반죽 형성시의 점탄성을 결정하는 밀 저장 단백질인 글루텐 특성에 관한 질적 형질 개 선에 초점을 맞추어 수행되고 있다(D’Ovidio & Masci 2004). 밀 글루텐은 알코올 수용액의 용해도에 따라 녹는 글 리아딘과 녹지 않는 글루테닌으로 구분되며, 밀의 점탄성은 주로 글루테닌에 의해 결정된다. 글루테닌은 분자량에 따라 다시 글루텐의 10%를 차지하는 고분자 글루테닌(HMW-GS, High Molecular Weight Glutenin Subunit)과 40%를 차지하 는 저분자 글루테닌(LMW-GS, Low Molecular Weight Glutenin Subunit)으로 구별되고, 각각 Glu-1과 Glu-3 유전 자가 관여한다(Gianibelli et al. 2001, Gupta & Shepherd 1990, Jackson et al. 1996, Payne et al. 1980, Wieser 2007). 고분자 글루테닌은 밀 글루텐의 10%를 차지하나 글루텐의 탄성 결정에 Key factor로 작용한다. 또한 고분자 글루테닌서 브유닛과 제빵 적성간에는 높은 상관관계가 있어, 이 고분자 글루테닌 서브유닛의 패턴을 이용하여 제빵 능력을 점수화하 는 Glu-1 점수체계가 확립되어 있고, 이 Glu-1점수체계를 이 용하여 Glu-1 유전자를 분석한 결과를 활용하면 복잡한 물성 테스트를 거치지 않고서도 간편한 가공적성 예측이 가능하여 세계 각국의 육종프로그램에 활용되고 있다(Park et al. 2012). 1987년에서 2006년 사이 Glu-1 allele 조합과 최종용 도 품질간의 상관관계에 대한 50여 편에 이르는 논문이 각국 에서 발표되었으며, 이들 대부분은 각국 기후에 적응한 품종 을 대상으로 공식기관에서 발표한 것들로 이 Glu-1점수체계 의 뛰어난 적용성을 보여준다(Khan & Shewry 2009). 국내 에서는 우수자원 탐색을 위한 글루테닌 조성 대량분석과 육 종활용은 초기 단계로, 1D 혹은 2D SDS-PAGE나 DNA마 커를 이용해 밀 가공적성에 많은 영향을 미치는 고분자, 저분 자 글루테닌 서브유닛의 분석을 통한 유전자원 탐색 연구가 최근 들어 시작되었다. 국내 20-30여종 밀 품종에 대한 분석 이 이뤄졌고(Lee et al. 2013, Park et al. 2012), DNA 분자 마커를 활용해 한국원산 재래종밀 자원을 대상으로 연구가 이 뤄지기도 했다(Ahn et al. 2014).
이 연구에서는 농업유전자원센터에서 보유중인 밀 유전자 원 중 유전적 다양성이 집적되어 있는 재래종 자원 중 국내재 배적응성이 높을 것으로 예상되는 한·중·일 동아시아 원산자 원의 고분자 글루테닌 조성을 SDS-PAGE와 DNA마커를 이 용하여 분석하고자 하였다. 이 중 Glu-1 점수가 높아 우수한 제빵가공적성을 지니고 숙기가 빨라 국내재배환경에도 적응 성이 뛰어난 유용한 우수자원을 선발하는 것을 목적으로 하 였다.
시험재료 및 기초특성조사
국립농업과학원 농업유전자원센터에서 보존하고 있는 재 래종 보통밀 자원 중 한국원산 299자원과 중국원산 155자원 과 더불어 일본 NIAS (National Institute of Agrobiological Sciences) Genebank 보유 일본원산 재래종 31자원 등 총 485자원을 공시재료로 하였고, 여기에 Chinese spring 등 Glu-1 loci의 allele가 알려진 총 8자원을 표준품종으로 공시 하였다. 생육기간 중 조숙성은 한국, 중국원산 재래종 밀 454 자원에 대해 2013-2014년 2년간에 걸쳐 조사되었고, 공시자 원은 각각 2012년 10월 25일, 2013년 10월 14일 수원시 탑 동에 위치한 식량원 신포장 노지에 자원간 재식거리 50 × 100 cm 관행파 줄뿌림으로 재배하였다. 숙기 조사를 위한 대 조품종으로는 조경, 조품, 우리, 금강밀을 공시하였다. 유전자 원특성조사 및 관리요령과 표준영농교본(Rural Development Administration 2003)에 준하여, 출수기는 총경수의 40% 이 상 출수한 날, 성숙기는 80%이상의 이삭이 황변하는 날로 정 하였다.
SDS-PAGE와 분자마커를 이용한 글루테닌 조성 분석

글루테닌 추출 및 SDS-PAGE 분석

글루테닌 추출 및 SDS-PAGE 분석은 Liu et al. (2010)의 방법을 일부 변형하여 사용하였다. 먼저 글루테닌 추출을 위 해 종자는 배를 제거하고 배유만 3,000 rpm, 10sec로 분쇄하 였다. 25 mg의 분쇄된 종자를 250 ul의 50% 1-propanol 첨가 후 상등액은 제거하였다. 여기에 100 ul의 glutenin extraction buffer (1% DTT, pH8.0 1M Tris-HCl, 50% 1-propanol)넣 어 원심분리한 후 20 ul의 상등액을 분리하여 5ul의 4-vinylpridine buffer (5% 4-vinylpuridine, pH8.0 1M Tris-HCl, 50% 1-propanol)를 넣었다. 60°C, 1시간 방치 후 acetone 100 ul을 첨가하고 상등액은 제거하였다. 여기에 30ul의 SDSPAGE buffer (125 m M Tris-HCl, 4%SDS, 20% glycerol, 0.01%BPB)와 30 ul의 증류수를 첨하여 65°C, 10분간 incubating하였다. 이 후 10% running gel (40% polyacrylamide, Tris HCl, 20% SDS, 10% APS, TEMED)를 사용해 200V, 2시간 loading 한 후 CBB staining solution으로 염색 하였다.

DNA마커를 이용한 PCR 분석

종자소독 후 육묘포트에 파종하여 온실에서 약 3주간 생육 후 유엽 3~4엽을 채취하여 동결건조한 후 변형된 CTAB (Dellaporta et al. 1983)법으로 DNA를 추출해 분석하였다. 구체적인 방법은 다음과 같다. 분쇄된 샘플 10 mg을 600 μl extraction buffer (Gentra puregene cell kit, Qiagen사)를 첨 가하여 섞은 뒤 60°C에서 1시간 둔 뒤 다시 200 μl의 chloroform를 첨가한 뒤 150 rpm, 20분간 원심분리하고, 30 분간 0°C에 둔다. Chloroform 첨가과정을 한번 더 반복한 뒤, 상등액 100 μl를 따서 100 μl의 isopropanol에 섞어준다. 원심분리 뒤 isopropanol은 제거한다. 70% ethanol 1 ml를 첨가해 씻어내고, enthanol를 제거한 후 100 μl의 TE buffer 를 첨가하여 녹인다.
PCR 조성은 genomic DNA는 40 ng, primer는 각각 0.14 ~0.4 umol/l, dNTP 0.8 mM/l, taq polymerase 0.25 unit (TaKaRa TaqTM, TaKaRa SapphireAmp PCR mastermix, Japan)으로 구성하였으며, 총 반응액은 10 μl로 하였다. Glu-1 loci의 각 allele별로 선별된 DNA 마커 6종을 이용하 였으며, 각 마커정보와 PCR 설정 정보는 Table 1, Table 2와 같다.
Table 1.
Sequence of primers for Glu-1 allele and expected PCR fragment size.
Table 1.
Allele Forward & Reverse Primer Reference Fragment size (bp) Annealing Temp. (°C)

Axnull F: ACGTTCCCCTACAGGTACTA Moczulski (2003) 920 65
R: TATCACTGGCTAGCCGACAA
Ax2*/Ax1 orAxnull F: CGAGACAATATGAGCAGCAAG Liu (2008) 344/362 60
R: CTGCCATGGAGAAGAAGTTGGA

Bx7/17 F: CGCAACAGCCAGGACAATT Ma (2003) 630+766/699 58
R: AGAGTTCTATCACTGCCTGGT
By8/9 F: TTCTCTGCATCAGTCAGGA Lei (2006) 662/707 59
R: AGAGAAGCTGTGTAATGCC

Dx2/Dx5 F: GGGACAATACGAGCAGCAAA Liu (2008) 281/299 60
R: CTTGTTCCGGTTGTTGCCA
Dy10/Dy12 F: CGCAAGACAATATGAGCAAACT Liu (2008) 397/415 60
R: TTGCCTTTGTCCTGTGTGC
Table 2.
Conditions of PCR for Glu-1 alleles.
Table 2.
Glu-A1xz Glu-B1xy Glu-B1yx Glu-D1xyw

PCR components
Taq DNA polymerase (U) 1 2x premix
dNTP (mmol/l) 0.8
each primer for a gene (umole/l) 0.26/0.14 0.4 0.4 0.26/0.14
concentration of DNA (ng) 40 40 40 40

PCR amplification condition
Denature 94°C 30s 98°C 5s 94°C 30s 98°C 5s
Annealing 60°C 30s 58°C 5s 60°C 30s 60°C 5s
Extension 72°C 1m 72°C 10s 72°C 30s 72°C 10s
No. of cycles 35 35 35 35

Gel electorphoresis
Agarose (%) 1.5 2 2 3
Voltage (V) 150 100 100 150
Time (min) 15 30 30 20

zGlu-Ax1, 2*, Null genes were analyzed

yGlu-Bx6,7,17 were analyzed

xGlu-By8,9,15,16 were analyzed

WGlu-Dx2,5, Glu-Dy10,12 were analyzed

유전자원 평가 Glu-1 점수체계 평가

각 allele별 조합과 제빵특성의 연관을 Glu-1 점수체계를 이용하여 평가하였다. Payne et al. (1987)에 의해 제안된 Glu-1 점수체계는 생화학적 표지인자로써 SDS 전기영동에 의해 분리되는 고분자 글루테닌 서브유닛의 패턴을 이용하여 밀 제빵능력을 예측함으로서 유전학적 정보를 육종에 혁명적 으로 적용한 사례이다. Glu-1 유전자좌의 각 allele 조합에 따 라 점수를 매기고, 각 allele별 점수가 합산되어 이 점수의 합 이 10점 만점이 되도록 구성되어 있으며, 점수가 높을수록 밀 가루 품질특성이 우수함을 의미한다. 이 Glu-1 점수체계는 각 국별로 상업용 이나 지역유래 품종 등 다양한 대상으로 각각 조금씩 다른 실험방법으로 광범위하게 적용되어 검증되었고, 새롭게 발견된 서브유닛에 대한 결과는 최초의 점수체계에 추가되었다(Khan & Shewry 2009). 이는 Table 3과 같다.
Table 3.
Scores assigned to individual High Molecular Weight Glutenin Subunitsz. (Khan and Shewry 2009)
Table 3.
Score Glu-A1 Glu-B1 Glu-D1

4 - - 5+10(d)
3 1(a), 2*(b) 17+18(i), 7+8(b), 7*+9y(c), 13+16(f), 14+15y(h) -
2 - - 2+12(a), 3+12(b)
1 Null(c) 7(a), 6+8(d), 20y(e) 4+12(c), 2.2+12x(f)

zSubunit scores were deduced by genetic analysis and quoted by Payne et al. (1987). And the basic scoring system was adapted from Cornish et al. (2006). Allele symbol in brackets was designated by McIntosh et al. (1998)

yThese subunits are upgraded or newly allocated after analyzing varieties from original Glu-1 scoring system

xfrom Takata (2003)

유전자원 다양성 평가

고분자 글루테닌을 구성하는 각 서브유닛의 조합을 바탕으 로 원산지별로 PIC (polymorphic information content index) 를 분석하여 유전적 다양성을 평가하였다. 또한 이 조합을 Nei (1973)의 방법에 따라 각 자원별로 유전적 거리를 계산 하고, PowerMarker software ver 3.25 (Liu & Muse 2005) 를 이용하여 UPGMA (unweighted pair group method using arithmetic algorithm) tree를 작성하였다.
조숙성 자원 선발을 위한 성숙기 조사
국내 작부체계상 논에서는 벼의 후작으로 벼수량 감소 없 이 이앙할 수 있어야 하고, 밭에서는 후작으로 콩, 고구마, 채 소 등과의 시기적 경합이 있기 때문에 밀의 조숙성은 매우 중 요한 형질 중 하나이다. 늦어도 6월 상순에 등숙 및 수확이 이루어져야 벼, 콩과의 작부체계 구성이 용이해진다. 또한 이 삭이 출수한 상태에서 장마로 비를 맞으면 수발아 등의 문제 도 있어 장마 전에 수확할 수 있어야 유리하다. 2014년 밀 표 준품종의 평균 출수기는 4월 17일, 성숙기는 5월 25일로 2013년의 평균 출수기 5월 4일, 평균 성숙기 6월 7일에 비해 각각 17일, 성숙기는 13일 빨랐다. 표준품종으로 사용된 국내 육성 품종들은 대부분 극조숙성 혹은 조숙성 자원들로 이들 보다 숙기가 빠르거나 비슷한 자원은 국내 재배 환경에서 이 용가능성이 높을 것으로 기대된다. 2013년에 출수·성숙기를 조사한 한국재래종 자원의 경우 표준품종보다 빠르거나 비슷 한 6월 상순 이전에 성숙한 자원은 43자원이었다. 2014년에 조사된 중국재래종 자원의 경우 표준품종과 같은 5월 하순 이 전에 성숙한 자원은 15자원이었다(Table 4). 벼 이앙기를 고 려하여 6월 상순 이전에 성숙한 자원은 총 169자원으로 이들 자원은 국내재배환경에서 숙기가 대체로 양호하다고 할 수 있다. 1차 특성으로 조숙성을 가진 자원 중에 글루테닌 조성 이 우수한 자원을 선발할 경우 육종효율을 높일 수 있어 국산 밀 품종 육성에 활용도가 높을 것으로 기대된다.
Table 4.
Distribution of Heading date and Maturity date of germplasm used in this study focusing on origin.
Table 4.
Heading date No. of accessions Maturity date No. of accessions


Koreax Chinay Total Korea China Total

Middle Apr 1 1
Late Apr 100 100 Late Mayw 15 15
Early May 49 49 Early Junx 43 111 154
Middle May 266 3 269 Middle Jun 235 28 263
Late May 32 2 34 Late Jun 21 1 22
Early Jun 1 1


Total 299 155 454 Total 299 155 454

zThe seeding date of accessions from Korea was 2012/10/25

yThe seeding date of accessions from China was 2013/10/14

xaverage maturity period of standard cultivars in 2013

waverage maturity period of standard cultivars in 2014

고분자 글루테닌 분석 및 Glu-1 점수평가
표준품종은 고분자 글루테닌 서브유닛 구성이 알려져 있는 품종 중 다양성을 고려하여 Chinese Spring 등 대표적인 8종 을 선발하였다(Lawrence GJ et al. 1987, Nakamura H et al, 1990, Payne PI et al. 1981). 표준품종의 Glu-1 loci의 각 allele 분석결과를 토대로(Table 5, Fig. 1) 한중일 3국의 재래 종밀 485자원의 고분자 글루테닌 조성패턴을 해석한 결과, 기존에 보고된 allele과 일치하는 자원은 총 381자원으로 전 체의 78.6%였고, 재래종 자원의 특성상 자원의 불균일성 등 으로 인해 특정 allele에 혼합된 양상을 보여 자원혼입이 있을 것으로 추정되는 자원은 27자원으로 5.6%이었고, DNA마커 분석결과와 SDS-PAGE 결과간 차이가 있어 해석이 어려운 자원은 64자원으로 13.2%를 차지했다. 전체 자원 중 13자원 (3.2%)은 기존의 보고와 일치하지 않는 새로운 밴드 패턴을 보이는 자원으로서 이 자원들은 추후 유전자 sequencing 등 을 통해 기존 밝혀지지 않은 새로운 고분자 글루테닌 유전자 를 밝히기 위한 추가적인 연구가 필요할 것으로 생각된다.
Fig. 1.
Evaluation of HMW-GS with standard line by using SDS-PAGE and DNAmarker. 1: Chinese spring, 2: Hope, 3: Bezostaya-1, 4: Gabo, 5: Danchi, 6: Halberd 7: Reeves 8: Yuunnanense.
KJBS-47-264_F1.gif
Table 5.
Allelic composition at loci Glu-A1, Glu-B1, Glu-D1 of 8 standard cultivars.
Table 5.
No. Standards’ name Glu-A1 Glu-B1 Glu-D1

1 Chinese Spring N 7+8 2+12
2 Hope 1 6+8 5+10
3 Bezostaya-1 2* 7*+9 5+10
4 Gabo 2* 17+18 2+12
5 Danchi 2* 7+8 2.2+12
6 Halberd 1 20 5+10
7 Loros 2* 13+16 4+12
8 Novosadska-100 N 7+8 2+12*
고분자 글루테닌 서브유닛이 결정된 381자원에서 Glu-A1 locus에서는 한국자원과 일본자원은 각각 88.0%, 79.3%의 자원이 Glu-A1c (null) allele를 지녀 가장 높은 빈도를 보였 으나, 중국자원의 경우 Glu-A1a (2 *) allele가 52.5%로 가장 높은 빈도를 보였다. 또한 Glu-B1 locus에서도 한국과 일본 자원은 Glu-B1b (7+8) allele를 가진 자원이 각각 65.7%와 62.1%를 차지해 역시 비슷한 양상을 보였다. 반면, 중국자원 은 Glu-B1c (7 *+9) allele를 가진 자원이 39.6%를 보여 다른 양상을 나타냈다. 또한 Glu-A1과 Glu-B1 locus에서 한국과 일본 자원의 경우 가장 비율이 높은 allele를 가진 자원의 비 율이 전체 자원 중 62.1~86.9%를 차지해 상당히 편중된 양 상을 보인 반면, 중국 자원의 경우 가장 높은 빈도를 보인 자 원의 경우에도 39.6~50.5%로 보다 다양한 양상을 보였다. 각 국가별로 고유하게 나타난 allele도 있었는데, Glu-B1f (13+16)와 Glu-D1e (2+10)의 경우 중국자원에만 있었다. Glu-B1d (6+8), Glu-B1e (20), Glu-D1c (4+12)의 경우 한국 자원만 가지고 있는 고유한 allele였다(Table 6) 지리적으로 매우 가까운 한중일 삼국의 재래종에서도 각국별로 고유한 allele가 나타나는 것은 2n = 6x = 42개의 염색체를 가지는 6배체 밀의 유전자 구성의 복잡함으로 인해 고분자 글루테닌 발현에 관여하는 유전자 또한 다양하고 그 변이도 큼을 반영 한다고 할 수 있다(Zohary & Hopf 1993).
Table 6.
Allelic variation of Glu-1 loci of 381 accessions from Korea, China, and Japan.
Table 6.
Locus allele subunit Korea China Japan Total

nz py n p n p n p

Glu-A1 a 1 14 5.6 53 52.5 4 13.8 71 18.7
b 2* 16 6.4 22 21.8 2 6.9 40 10.5
c Null 221 88.0 26 25.7 23 79.3 270 71.1

Glu-B1 b 7+8 165 65.7 27 26.7 18 62.1 210 55.3
c 7*+9 9 3.6 40 39.6 1 3.4 50 13.2
d 6+8 2 0.8 - - - - 2 0.5
e 20 1 0.4 - - - - 1 0.3
f 13+16 - - 1 1.0 - - 1 0.3
h 7+15 10 4.0 5 5.0 - - 15 3.9
i 17+18 2 0.8 12 11.9 - - 14 3.7
u 7*+8 62 24.7 16 15.8 10 34.5 88 23.2

Glu-D1 a 2+12 160 63.7 63 62.4 21 72.4 244 64.2
b 3+12 3 1.2 - - - - 3 0.8
c 4+12 1 0.4 - - - - 1 0.3
d 5+10 4 1.6 37 36.6 1 3.4 42 11.1
e 2+10 - - 1 1.0 - - 1 0.3
f 2.2+12 83 33.1 - - 7 24.1 90 23.7

zNumber of accessions

yFrequency shown as percentage

Glu-1 점수체계는 밀 고분자 글루테닌 조성으로 자원의 제 빵품질을 10점 만점으로 점수화하여 간편하게 자원을 평가할 수 있어 전세계 밀 육종프로그램에 널리 사용되고 있다. 그러 나 비교적 최근에 보고된 allele의 경우 Glu-1 점수를 매길 수 없는 경우가 있어, 이를 제외한 291자원에 대한 평가를 실시 한 결과 총 26점의 자원이 만점자원이었다. 이중 중국원산 자 원이 총 23점으로 유전적 조성이 뛰어난 것으로 나타났다. 나 머지 3자원은 한국 자원이었고, 일본 자원 중에 만점 자원은 없었다. 전체 자원 중의 Glu-1점수 분포를 살펴보면 6점 자원 이 147자원으로 가장 많았으며, 8점 이상의 비교적 우수한 자 원은 84자원이었다(Table 7). 또한 Glu-1점수 체계에 있어 10점 만점을 획득하려면 반드시 필요할 뿐 아니라, 제빵 특성 관련하여 특히 선호도가 높은 Glu-D1d allele를 지닌 자원은 총 42자원이었으며, 각각 한국 원산 4자원, 중국 원산 37자 원, 일본 원산 1자원으로 나타났다. 이 중 만점 자원을 제외하 고는 한국원산 1자원, 중국원산 14자원, 일본자원 1자원으로 총 16자원이었다(Table 6). 만점 자원이거나 Glu-D1d allele 를 가지고 있는 유전자원의 경우, 역시 Glu-D1d allele를 가 진 국내 유일한 제빵용 품종인 조경밀과 같이 제빵용 국산밀 품종을 육성하는데 이용가능성이 클 것으로 기대된다.
Table 7.
Origin specific variation of Glu-1 score.
Table 7.
Origin Glu-1 score

4 5 6 7 8 9 10

Korea 51 122 6 6 3
China 13 48 23
Japan 3 12 4

Total - 54 147 6 58 - 26
원산지별 유전적 다양성 비교
유전적 다양성을 분석하기 위해 고분자글루테닌의 각 allele의 조합을 기준으로 하여 원산지별 PIC value 분석을 실시한 결과, 중국원산 자원은 한국, 일본 자원에 비해 PIC value가 0.53으로 월등히 높은 것으로 나타났다(Table 8). 역 시 위의 조합을 기준으로 유전적 유사성을 알아보기 위한 UPGMA분석을 실시한 결과는 각 Glu-A1, B1 locus에서 가 장 높은 빈도를 보이는 allele의 구성이 일치한 한국, 일본 원 산 자원의 경우 대부분 자원이 UPGMA tree상 Group I 에 속했다. 이와는 다른 구성을 보인 중국원산 자원의 경우 대부 분의 자원이 GroupⅡ에 속해 한일 양국 자원과는 구별되는 특성을 보였다(Fig. 2). 중국의 경우, 빵밀은 약 기원전 3000 년경에 도입되어 5000년이 넘는 오랜 재배역사를 지녔으며, 중국내의 다양한 지리적, 기후적 환경에서 다양한 용도로 재 배, 선발되는 과정에서 높은 유전적 다양성이 집적되었다고 알려져 있다. 따라서 한국과 일본의 비해 재래종의 유전적 다 양성이 훨씬 높을 것으로 생각된다. 중국의 국립작물종자은행 은 중국원산 재래종밀만 13,900점이 넘게 보유하고 있다고 알려져 있다(Yong Liu 2007). 한국과 일본자원의 경우 유전 적 다양성이 낮고 그 특성이 비슷한데 이는 장마 등 비슷한 기후재배조건과 동계작물로 재배하는 유사한 작부체계, 밀을 주식으로 사용하지 않은 전통적 식문화 등 유사성이 높기 때 문인 것으로 생각된다.
Fig. 2.
Unweighted pair group method using arithmetic algorithm (UPGMA) tree of accessions based on the HMW glutenin subunit composition of each accession. Blue colored accessions are originated from Korea, red ones are china, and green ones are Japan. Major two groups are GroupI and GroupⅡ are separated from the beginning.
KJBS-47-264_F2.gif
Table 8.
Origin specific variation of PIC value.
Table 8.
Origin No. of accession No. of compostion PICz

Korea 251 27 0.35
China 101 26 0.53
Japan 29 9 0.35

zPIC = 1eq

Glu-1 만점 자원 및 Glu-D1d를 가진 자원의 성숙기 분포
Glu-1 만점 자원의 출수기와 성숙기를 조사한 결과, 6월 상순 이전에 성숙되는 자원은 16점으로 이들 16점은 모두 중 국 원산 자원이었다. 2014년은 예년에 비해 표준품종의 숙기 가 13일 가량 빨랐는데, 이를 감안하여 벼 이앙기 기준인 6월 상순이 아닌, 국내품종과 비슷한 숙기인 5월 하순 이내에 성 숙한 자원이어야 예년 기준으로 조숙성 자원일 것으로 생각 되었다. 확인 결과, K151847, K151865, K151962 3자원의 성숙기가 5월 30일로, 표준품종의 성숙기인 5월 21일~5월 27일과 3일에서 9일 가량 차이가 났다. 극조숙성인 조품을 제 외한 국내에서 주로 재배되는 금강밀(5월 26일)과 국내 유일 의 제빵용 품종인 조경밀(5월 27일)의 성숙기와는 3~4일 가 량 차이나는 데 그쳐, 이용가능성이 높을 것으로 기대된다. 그 러나 만점을 받은 한국원산 3자원의 경우, 각각 성숙기가 6월 17일, 21일, 27일로서 6월 중하순에 성숙하였다. 2013년 재 배한 표준품종의 평균성숙기인 6월 7일에 비해 10일에서 20 일 가량 느려 이들 자원을 바로 육종에 활용하기에는 제약이 있는 것으로 생각된다(Table 9, Fig. 3).
Fig. 3.
Distribution of maturity period of accessions which got full mark of Glu-1 score (A) and Glu-D1d allele (B) Red bars means preferable maturity period considering double cropping with rice.
KJBS-47-264_F3.gif
Table 9.
Accessions having perfect 10 glu-1 score or Glu-D1d allele with early maturityz.
Table 9.
Accession No. Origin Heading time Maturity date

10 out of 10 for Glu-1 score IT215901 CHN 4/30 6/5
IT229787 CHN 4/29 6/10
IT246662 CHN 5/2 6/5
K151836 CHN 4/26 6/5
K151837 CHN 4/28 6/5
K151838 CHN 4/28 6/5
K151839 CHN 4/28 6/9
K151843 CHN 4/26 6/5
K151847y CHN 4/28 5/30
K151865y CHN 4/29 5/30
K151870 CHN 4/28 6/2
K151893 CHN 5/1 6/10
K151917 CHN 4/29 6/5
K151928 CHN 4/30 6/5
K151929 CHN 4/30 6/5
K151962y CHN 4/24 5/30

Glu-D1d allele K151835 CHN 4/28 6/10
K151844 CHN 4/28 6/5
K151858y CHN 4/26 5/30
K151875 CHN 4/29 6/5
K151876 CHN 4/30 6/5
K151896 CHN 4/28 6/10
K151898 CHN 4/29 6/5
K151918 CHN 4/29 6/5
K151919 CHN 4/29 6/5
K151921 CHN 4/30 6/5
K151922 CHN 4/30 6/5
K151924 CHN 4/29 6/5
K151925 CHN 4/30 6/5
K151933 CHN 5/3 6/10

zBefore 10th June considering double cropping with rice

yAccession with especially early maturity

한편, 만점 자원 외 선호되는 고분자 글루테닌 관련 유전자 인 Glu-D1d를 가지고 있는 자원은 총 42자원으로 이중 만점 자원을 제외한 16자원의 성숙기에 대해 조사한 결과, 한국원 산 1자원의 경우 6월 28일로 다소 늦었다. 반면, 중국 원산 자원 중 K151858의 경우 성숙기가 5월 30일로 표준품종의 성숙기와 비슷하여 활용가능성이 높았고, 다른 자원들의 경우 에도 6월 5일에서 10일까지 성숙기가 분포해 비교적 양호하 였다(Table 9, Fig. 3).
제빵특성이 우수한 외국산 밀 품종은 많지만, 실제로는 동 계작물로 재배하는 독특한 국내환경상 숙기조건에 맞는 자원 이 드물어 도입품종을 바로 활용하기는 쉽지 않다. 따라서 국 내 재배환경에서 조숙성을 가지면서도 글루테닌의 질적 조성 도 우수한 자원들은 국산밀 육종에 높은 이용가능성이 있을 것이다. 밀 육종에 있어 숙기 단축에 오랜 시간이 걸리는 만 큼 향후 1차적으로 국내재배환경에 적합한 조숙성을 가진 자 원을 선발하고, 가공적성, 내병충성, 내재해성 등 국내요구도 가 높은 다양한 형질을 평가하여 우수자원을 육종에 활용하 면 국산밀 육종효율성을 높이는데 기여할 수 있을 것으로 기 대된다.
본 연구는 국립농업과학원 농업유전자원센터와 일본 NIAS 가 보유하고 있는 밀 유전자원 중 한국, 일본, 중국원산 밀 재 래종 유전자원 486자원을 대상으로, 국내 적응성판별을 위한 성숙기 특성과 제빵 특성평가를 위하여 분자마커와 SDS-PAGE 를 이용하여 고분자글루테닌 조성을 분석하였으며, 또한 이에 대한 원산지별 유전적 다양성을 조사하고 유용자원을 선발하 였다. 결과는 다음과 같다. 첫째, SDS-PAGE와 DNA marker 를 이용한 고분자글루테닌 분석결과 기존의 보고와 조성패턴 이 일치하는 자원은 전체의 381자원으로 78.6%이고, 이중 24자원은(5.6%)는 재래종 유전자원 특성상 불균일성으로 인 해 한 allele에 중첩된 band pattern을 보이는 자원이었으며, 13자원(3.2%)은 기존보고에서 볼 수 없는 새로운 band pattern 을 보이는 자원으로 비슷한 유형별로 그룹화해 추후 DNA sequencing 분석이 필요할 것으로 생각된다. 둘째, 한국과 일 본 자원의 경우 Glu-A1과 Glu-B1 locus에서 Glu-A1c (null) 와 Glu-B1b (7+8) allele이 가장 높은 빈도를 보였으나, 중국 자원의 경우 Glu-A1a (2 *)와 Glu-B1c (7 *+9)가 가장 높은 빈 도를 보여 그 양상이 달랐다. 셋째, Glu-B1d (6+8)과 Glu-B1e (20), Glu-D1b(3+12), Glu-D1c(4+12)는 한국자원 만 가지고 있는 특이 allele이었고, Glu-B1f (13+16)과 Glu-D1e (2+10)의 경우 오직 중국자원만 가지고 있는 독특 한 allele로서 원산지별로 고유한 allele이 존재하였다. 넷째, 고분자 글루테닌 subunit 조합을 기준으로 하여 PIC 및 UPGMA 분석을 통해 유전적 다양성을 분석한 결과 중국자 원(PIC value 0.53)의 경우 한국, 일본 자원(PIC value 0.35) 보다 유전적 다양성이 높은 것으로 나타났다. 또한 UPGMA tree상 한국, 일본의 유전자원 대부분이 Group I 에 속하는 것과 달리 중국자원의 대부분은 GroupⅡ에 속해 양국과는 구별되는 특성을 보였다. 다섯째, 총 291자원에 대한 Glu-1점 수평가를 실시한 결과, 총 26자원이 10점 만점 자원이었다. 이중 중국원산 자원이 23자원, 한국원산 자원은 3자원이었다. 선호되는 allele인 Glu-D1d를 가진 자원은 만점 자원을 제외 하고 총 16점이 있었다. 또한 전체 자원 중에는 6점의 자원이 147자원으로 가장 많았고, 8점 이상의 비교적 우수한 조성의 자원은 84자원이었다. 여섯째, 선발된 만점 자원의 출수기, 성 숙기를 조사한 결과, 6월 상순 이전에 성숙한 자원은 16자원으 로 특히 이중 3자원(K151847, K151865, K151962)은 극조숙 성인 국내품종들의 숙기와 비슷한 5월 하순 성숙해 특히 이용 가능성이 높을 것으로 기대된다.
본 연구는 농촌진흥청 농업과학기술연구 개발사업(과제번 호: PJ010871)의 지원에 의해 이루어졌습니다.
  • 1. Ahn JH, Lee SK, Park CS. Evaluation of genetic variation at glutenin loci in Korean wheat landraces using allele-specific DNA markers. Plant Genet. Resour.-Charact.Util 2014. 12: 353-356.
  • 2. Borlaug NE. Wheat breeding and its impact on world food supply. Australian Academy of Science 1968. 1335.
  • 3. CornishGB. BekesF. EaglesHA. PaynePI. Prediction of dough properties for bread wheats. Wringley CW, Bekes F, Bushuk W. Gliadin and Glutenin: the unique balance of wheat quality St.Paul, MN, Am. Assoc. Cereal Chem. 2006. 243-280.
  • 4. Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation. Plant Mol. Biol. Rep 1983. versionⅡ. 19-21.
  • 5. D'Ovidio R, Masci S. The low-molecular-weight glutenin subunits of wheat gluten. J. Cereal Sci 2004. 39: 321-339.
  • 6. Gianibelli MC, Larroque OR, MacRitchie F, Wrigley CW. Biochemical, genetic, and molecular characterization of wheat glutenin and its component subunits. Cereal Chem 2001. 78: 635-646.
  • 7. Gupta RB, Shepherd KW. Two-step one-dimensional SDS-PAGE analysis of LMW subunits of glutenin. Theor. Appl. Genet 1990. 80: 65-74.
  • 8. Jackson EA, Morel MH, Sontag Strohm T, Branlard G, Metakovsky EV, Redaelli R. Proposal for combining the classification systems of alleles of Gli-1 and Glu-3 loci in bread wheat (Triticum aestivum L). J. Genet. Breeding 1996. 50: 321-336.
  • 9. Jin HJ, Kim MK, Lee CH. An analysis regarding main factors for increased self-sufficiency of wheat in Japan. Korean J. Food Marketing Economics 2011. 28: 79-109.
  • 10. KhanK. ShewryPR. Wheat: chemistry and technology. Shewry PR, D’Ovidio R, Lafiandra D, Jenkins JA, Mills ENC, Bekes F. Wheat grain protein St.Paul, MN, Am. Assoc. Cereal Chem. 2009. 223-278.
  • 11. Kihara H. Discovery of the DD-analyser, one of the ancestors of Triticum vulgare. Agric Hortic 1944. 19: 13-14.
  • 12. Lawrence GJ, Moss HJ, Shepherd KW, Wrigley CW. Dough quality of biotypes of eleven Australian wheat cultivars that differ in High-Molecular-Weight glutenin subunit composition. J. Creal. Sci 1987. 6: 99-101.
  • 13. Lee JY, Park CS, Kim HJ, Kim JH, Kim MS, Kim YT, Kang CS, Lim SH, Ha SH, Ahn SN, Kim YM. Two-dimensional electrophoresis of high molecular weight glutenin subunits in Korean wheat cultivars. Korean J. Breed. Sci 2013. 45: 240-252.
  • 14. Lee JY, Beom HR, Kim YT, Lim SH, Yoon UH, Kim CK, Seol YJ, Lee CH, Lee HJ, Kim YM. Low molecular-weight glutenin subunits in Common wheat. Korean J. Breed. Sci 2014. 46: 342-352.
  • 15. Lei ZS, Gale KR, He ZH, Gianibelli C, Larroque O, Xia XC, Ma W. Y-type gene specific markers for enhanced discrimination of high-molecular weight glutenin alleles at the Glu-B1 locus in hexaploid wheat. J. Cereal. Sci 2006. 43: 94-101.
  • 16. Liu K, Muse SV. PowerMarker: Integrated analysis environment for genetic marker data. Bioinformatics 2005. 21: 2128-2129.
  • 17. Liu L, Ikeda TM, Branlard G, Pena RJ, Rogers WJ, Lerner SE, He Z. Comparison of low molecular weight glutenin subunits identified by SDS-PAGE, 2-DE, Maldi-TOF-MS and PCR in common wheat. BMC plant Biol 2010. 10: -124.
  • 18. Liu S, Chao S, Anderson JA. New DNA markers for high molecular weight glutenin subunits in wheat. Theor. Appl. Genet 2008. 118: 177-183.
  • 19. Liu Y, Xiong ZY, He YG, Shewry PR, He GY. Genetic diversity of HMW glutenin subunit in Chinese common wheat (Triticum aestivum L.) landraces from Hubei province. Genet. Resour. Crop Evol 2007. 54: 865-874.
  • 20. Ma W, Zhang W, Gale KR. Multiplex PCR typing of high molecular weight glutenin alleles in wheat. Euphytica 2003. 134: 51-60.
  • 21. McFadden ES, Sears ER. The origin of Triticum spelta and its free threshing hexaploid relatives. J.Hered 1946. 37: 107-116.
  • 22. McIntoshRA. HartGE. DevosKM. GaleMD. RogersWJ. Catalogue of gene symbols for wheat . Slinkard AE. Proc.9th Int. Wheat genetic sympos Saskatoon, Canada, University of Sakatchewan, University Extension Press. 1998. 5: 1-236.
  • 23. Ministry of AgricultureFood and Rural Affairs. Key statistics of agriculture, Forestry, livestock and food 2014. 282-294.
  • 24. Moczulski M, Salmanowicz BP. Multiplex PCR identification of wheat HMW glutenin subunit genes by allele-specific markers. J. Appl. Genetics 2003. 44: 459-472.
  • 25. Nakamura H, Inazu A, Hirano H. Allelic variation in high-molecular-weight glutenin subunit loci of Glu-1 in Japanese common wheats. Euphytica 1999. 106: 131-138.
  • 26. Nakamura T, Vrinten P, Saito M, Konda M. Rapid classification of partial waxy wheats using PCR based markers. Genome 2002. 45: 1150-1156.
  • 27. Nei M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973. 70: 3321-3323.
  • 28. Park CS, Shin SH, Kang CS, Kim KH. Analysis of glutenin compositions in Korean wheat cultivar using SDS-PAGE and PCR. Korean J. Breed. Sci 2012. 44: 245-257.
  • 29. Payne PI. Genetics of wheat storage proteins and the effect of allelic variation on bread-making quality. Ann. Rev. Plant Physiol 1987. 38: 141-153.
  • 30. Payne PI, Holt LM, Law CN. Structural and genetical studies on the High-molecular-weight subunits of wheat glutenin. Theor. Appl. Genet 1981. 60: 229-236.
  • 31. Payne PI, Law CN, Mudd EE. Control by homologous group I chromosomes of the high-molecularweight subunits of glutenin, a major protein of wheat endosperm. Theor. Appl. Genet 1980. 58: 113-120.
  • 32. Payne PI, Nightingale MA, Krattiger AF, Holt LM. The relationship between HMW glutenin subunit composition and bread-making quality of British-grown wheat varieties. J. Sci. Food. Agric 1987. 40: 51-65.
  • 33. Rudd JC, Horsley RD, McKendry AL, Elias EM. Host plant resistance genes for Fusarium head blight. Crop Sci 2001. 41: 620-627.
  • 34. Rural Development AdministrationThe Analysis Standard of Research and Investigation for Agricultural Science Technology 2003.
  • 35. Rural Development AdministrationThe Analysis Standard of Research and Investigation for Agricultural Science Technology 2012.
  • 36. Rural Development Administration Farming Standards Handbook: wheat 2011. Kang CS, Kim KH, Kim YJ, Jung YG, Kang MS. 70-71.
  • 37. Takata K, Nishio Z, Funatsuki W, Kuwabara T, Yamauchi H. Difference in combination between Glu-B1 and Glu-D1 alleles in bread-making quality using near-isogenic lines. Food Sci. Technol. Res 2003. 9: 67-72.
  • 38. Wieser H. Chemistry of glutenin proteins. Food Micro 2007. 24: 115-119.
  • 39. Zohary D, Hopf M. Domestication of plants in the world. The origin and spread of cultivated plants in west Asia, Europe and the Nile valley 1993. Clarendon Press. Oxford.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period
Korean. J. Breed. Sci.. 2015;47(3):264-275.   Published online September 30, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period
Korean. J. Breed. Sci.. 2015;47(3):264-275.   Published online September 30, 2015
Close

Figure

  • 0
  • 1
  • 2
Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period
Image Image Image
Fig. 1. Evaluation of HMW-GS with standard line by using SDS-PAGE and DNAmarker. 1: Chinese spring, 2: Hope, 3: Bezostaya-1, 4: Gabo, 5: Danchi, 6: Halberd 7: Reeves 8: Yuunnanense.
Fig. 2. Unweighted pair group method using arithmetic algorithm (UPGMA) tree of accessions based on the HMW glutenin subunit composition of each accession. Blue colored accessions are originated from Korea, red ones are china, and green ones are Japan. Major two groups are GroupI and GroupⅡ are separated from the beginning.
Fig. 3. Distribution of maturity period of accessions which got full mark of Glu-1 score (A) and Glu-D1d allele (B) Red bars means preferable maturity period considering double cropping with rice.
Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period

Sequence of primers for Glu-1 allele and expected PCR fragment size.

Allele Forward & Reverse Primer Reference Fragment size (bp) Annealing Temp. (°C)

Axnull F: ACGTTCCCCTACAGGTACTA Moczulski (2003) 920 65
R: TATCACTGGCTAGCCGACAA
Ax2*/Ax1 orAxnull F: CGAGACAATATGAGCAGCAAG Liu (2008) 344/362 60
R: CTGCCATGGAGAAGAAGTTGGA

Bx7/17 F: CGCAACAGCCAGGACAATT Ma (2003) 630+766/699 58
R: AGAGTTCTATCACTGCCTGGT
By8/9 F: TTCTCTGCATCAGTCAGGA Lei (2006) 662/707 59
R: AGAGAAGCTGTGTAATGCC

Dx2/Dx5 F: GGGACAATACGAGCAGCAAA Liu (2008) 281/299 60
R: CTTGTTCCGGTTGTTGCCA
Dy10/Dy12 F: CGCAAGACAATATGAGCAAACT Liu (2008) 397/415 60
R: TTGCCTTTGTCCTGTGTGC

Conditions of PCR for Glu-1 alleles.

Glu-A1xz Glu-B1xy Glu-B1yx Glu-D1xyw

PCR components
Taq DNA polymerase (U) 1 2x premix
dNTP (mmol/l) 0.8
each primer for a gene (umole/l) 0.26/0.14 0.4 0.4 0.26/0.14
concentration of DNA (ng) 40 40 40 40

PCR amplification condition
Denature 94°C 30s 98°C 5s 94°C 30s 98°C 5s
Annealing 60°C 30s 58°C 5s 60°C 30s 60°C 5s
Extension 72°C 1m 72°C 10s 72°C 30s 72°C 10s
No. of cycles 35 35 35 35

Gel electorphoresis
Agarose (%) 1.5 2 2 3
Voltage (V) 150 100 100 150
Time (min) 15 30 30 20

zGlu-Ax1, 2*, Null genes were analyzed

yGlu-Bx6,7,17 were analyzed

xGlu-By8,9,15,16 were analyzed

WGlu-Dx2,5, Glu-Dy10,12 were analyzed

Scores assigned to individual High Molecular Weight Glutenin Subunitsz. (Khan and Shewry 2009)

Score Glu-A1 Glu-B1 Glu-D1

4 - - 5+10(d)
3 1(a), 2*(b) 17+18(i), 7+8(b), 7*+9y(c), 13+16(f), 14+15y(h) -
2 - - 2+12(a), 3+12(b)
1 Null(c) 7(a), 6+8(d), 20y(e) 4+12(c), 2.2+12x(f)

zSubunit scores were deduced by genetic analysis and quoted by Payne et al. (1987). And the basic scoring system was adapted from Cornish et al. (2006). Allele symbol in brackets was designated by McIntosh et al. (1998)

yThese subunits are upgraded or newly allocated after analyzing varieties from original Glu-1 scoring system

xfrom Takata (2003)

Distribution of Heading date and Maturity date of germplasm used in this study focusing on origin.

Heading date No. of accessions Maturity date No. of accessions


Koreax Chinay Total Korea China Total

Middle Apr 1 1
Late Apr 100 100 Late Mayw 15 15
Early May 49 49 Early Junx 43 111 154
Middle May 266 3 269 Middle Jun 235 28 263
Late May 32 2 34 Late Jun 21 1 22
Early Jun 1 1


Total 299 155 454 Total 299 155 454

zThe seeding date of accessions from Korea was 2012/10/25

yThe seeding date of accessions from China was 2013/10/14

xaverage maturity period of standard cultivars in 2013

waverage maturity period of standard cultivars in 2014

Allelic composition at loci Glu-A1, Glu-B1, Glu-D1 of 8 standard cultivars.

No. Standards’ name Glu-A1 Glu-B1 Glu-D1

1 Chinese Spring N 7+8 2+12
2 Hope 1 6+8 5+10
3 Bezostaya-1 2* 7*+9 5+10
4 Gabo 2* 17+18 2+12
5 Danchi 2* 7+8 2.2+12
6 Halberd 1 20 5+10
7 Loros 2* 13+16 4+12
8 Novosadska-100 N 7+8 2+12*

Allelic variation of Glu-1 loci of 381 accessions from Korea, China, and Japan.

Locus allele subunit Korea China Japan Total

nz py n p n p n p

Glu-A1 a 1 14 5.6 53 52.5 4 13.8 71 18.7
b 2* 16 6.4 22 21.8 2 6.9 40 10.5
c Null 221 88.0 26 25.7 23 79.3 270 71.1

Glu-B1 b 7+8 165 65.7 27 26.7 18 62.1 210 55.3
c 7*+9 9 3.6 40 39.6 1 3.4 50 13.2
d 6+8 2 0.8 - - - - 2 0.5
e 20 1 0.4 - - - - 1 0.3
f 13+16 - - 1 1.0 - - 1 0.3
h 7+15 10 4.0 5 5.0 - - 15 3.9
i 17+18 2 0.8 12 11.9 - - 14 3.7
u 7*+8 62 24.7 16 15.8 10 34.5 88 23.2

Glu-D1 a 2+12 160 63.7 63 62.4 21 72.4 244 64.2
b 3+12 3 1.2 - - - - 3 0.8
c 4+12 1 0.4 - - - - 1 0.3
d 5+10 4 1.6 37 36.6 1 3.4 42 11.1
e 2+10 - - 1 1.0 - - 1 0.3
f 2.2+12 83 33.1 - - 7 24.1 90 23.7

zNumber of accessions

yFrequency shown as percentage

Origin specific variation of Glu-1 score.

Origin Glu-1 score

4 5 6 7 8 9 10

Korea 51 122 6 6 3
China 13 48 23
Japan 3 12 4

Total - 54 147 6 58 - 26

Origin specific variation of PIC value.

Origin No. of accession No. of compostion PICz

Korea 251 27 0.35
China 101 26 0.53
Japan 29 9 0.35

zPIC = 1eq

Accessions having perfect 10 glu-1 score or Glu-D1d allele with early maturityz.

Accession No. Origin Heading time Maturity date

10 out of 10 for Glu-1 score IT215901 CHN 4/30 6/5
IT229787 CHN 4/29 6/10
IT246662 CHN 5/2 6/5
K151836 CHN 4/26 6/5
K151837 CHN 4/28 6/5
K151838 CHN 4/28 6/5
K151839 CHN 4/28 6/9
K151843 CHN 4/26 6/5
K151847y CHN 4/28 5/30
K151865y CHN 4/29 5/30
K151870 CHN 4/28 6/2
K151893 CHN 5/1 6/10
K151917 CHN 4/29 6/5
K151928 CHN 4/30 6/5
K151929 CHN 4/30 6/5
K151962y CHN 4/24 5/30

Glu-D1d allele K151835 CHN 4/28 6/10
K151844 CHN 4/28 6/5
K151858y CHN 4/26 5/30
K151875 CHN 4/29 6/5
K151876 CHN 4/30 6/5
K151896 CHN 4/28 6/10
K151898 CHN 4/29 6/5
K151918 CHN 4/29 6/5
K151919 CHN 4/29 6/5
K151921 CHN 4/30 6/5
K151922 CHN 4/30 6/5
K151924 CHN 4/29 6/5
K151925 CHN 4/30 6/5
K151933 CHN 5/3 6/10

zBefore 10th June considering double cropping with rice

yAccession with especially early maturity

Table 1. Sequence of primers for Glu-1 allele and expected PCR fragment size.
Table 2. Conditions of PCR for Glu-1 alleles.

Glu-Ax1, 2*, Null genes were analyzed

Glu-Bx6,7,17 were analyzed

Glu-By8,9,15,16 were analyzed

Glu-Dx2,5, Glu-Dy10,12 were analyzed

Table 3. Scores assigned to individual High Molecular Weight Glutenin Subunitsz. (Khan and Shewry 2009)

Subunit scores were deduced by genetic analysis and quoted by Payne et al. (1987). And the basic scoring system was adapted from Cornish et al. (2006). Allele symbol in brackets was designated by McIntosh et al. (1998)

These subunits are upgraded or newly allocated after analyzing varieties from original Glu-1 scoring system

from Takata (2003)

Table 4. Distribution of Heading date and Maturity date of germplasm used in this study focusing on origin.

The seeding date of accessions from Korea was 2012/10/25

The seeding date of accessions from China was 2013/10/14

average maturity period of standard cultivars in 2013

average maturity period of standard cultivars in 2014

Table 5. Allelic composition at loci Glu-A1, Glu-B1, Glu-D1 of 8 standard cultivars.
Table 6. Allelic variation of Glu-1 loci of 381 accessions from Korea, China, and Japan.

Number of accessions

Frequency shown as percentage

Table 7. Origin specific variation of Glu-1 score.
Table 8. Origin specific variation of PIC value.

PIC = 1eq

Table 9. Accessions having perfect 10 glu-1 score or Glu-D1d allele with early maturityz.

Before 10th June considering double cropping with rice

Accession with especially early maturity