Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

국내에서 수집된 자두의 품종식별을 위한 SSR Profile 데이터베이스 구축

Construction of SSR Profile Database for Variety Identification of Plum Collected in Korea

Korean Journal of Breeding Science 2015;47(2):97-104.
Published online: May 31, 2015

1 농림축산식품부 국립종자원 종자검정연구센터

1 Seed Testing & Research Center, Korea Seed & Variety Service, Ministry of Agriculture, Food and Rural Affairs, Gimcheon 740-220, Korea

2 경북농업기술원 청도복숭아시험장

2 Cheongdo Peach Experiment Station, Gyeongsangbuk-do Agricultural Technology Administration, Cheongdo,714-851, Korea

*Corresponding author (hongjh19@korea.kr Tel: +82-54- 912-0230, Fax: +82-54-912-0227)
• Received: March 21, 2015   • Revised: March 25, 2015   • Accepted: April 23, 2015

© Korean Society of Breeding Science All rights reserved

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 186 Views
  • 0 Download
  • 1 Crossref
next

Citations

Citations to this article as recorded by  Crossref logo
  • Assessment of Genetic Diversity and Interspecific Relationships of the Genus Viburnum Inferred from Start Codon Targeted (SCoT) Polymorphism Markers
    Choi I-Jin, Park Hey-Min, Kim Hyun-Kyung
    Ecology and Diversity.2026; 3(1): 10002.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Construction of SSR Profile Database for Variety Identification of Plum Collected in Korea
Korean. J. Breed. Sci.. 2015;47(2):97-104.   Published online June 30, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Construction of SSR Profile Database for Variety Identification of Plum Collected in Korea
Korean. J. Breed. Sci.. 2015;47(2):97-104.   Published online June 30, 2015
Close

Figure

  • 0
  • 1
Construction of SSR Profile Database for Variety Identification of Plum Collected in Korea
Image Image
Figure. 1. Four simple sequence repeat markers showing polymorphism among 8 plum varieties. The PCR products were separated using a QIAxcel Advanced System (QIAGEN). Lane 1 : Oishiwase, 2 : Formosa, 3 : Shihou, 4 : Kiyou, 5 : Santa Rosa, 6 : Purple Queen, 7 : Honey Red, 8 : Beniryozen.
Figure. 2. Genetic relationship of 38 plum varieties using 21 simple sequence repeat markers. The scale at the bottom is Jaccard’s coefficient of similarity. The dotted line refer to a similarity level of 0.21.
Construction of SSR Profile Database for Variety Identification of Plum Collected in Korea

The thirty-eight plum varieties used for construction of simple sequence repeat profile database.

No. Varieties Scientific name Origin Breeding year History

1 Oishiwase Prunus salicina Japan 1952 Formosa OPz
2 Benikayama Prunus salicina Japan unknown CSy of Santa Rosa or Soldam
3 Formosa Prunus salicina USA 1907 unknown
4 Purple Queen Prunus salicina Korea 2001 Soldam OP
5 Shihou Prunus salicina unknown unknown Wolguang x Oishiwase
6 Beniryozen Prunus salicina Japan 1987 Mammoth or Cardinal x Oishiwase
7 Riou Prunus salicina Japan 1990 Oshiwase x Soldam
8 Santa Rosa Prunus salicina USA unknown unknown
9 Oishinakate Prunus salicina Japan 1956 Formosa OP
10 Late Soldam Prunus salicina Japan 1973 Soldam mutation
11 Kiyou Prunus salicina Japan 1996 Taiyo OP
12 Soldam Prunus salicina unknown unknown Introduced from USA to Japan
13 Explorer Prunus salicina USA 1967 Queen Ann x Santa Rosa
14 Plum Inoue Prunus salicina Japan unknown Oishiwase OP
15 Dawang plum Prunus salicina unknown unknown Formosa CS
16 Taiyo Prunus salicina Japan unknown Introduced from USA to Japan
17 Fortune Prunus salicina USA 1971 Laroda x (Queen Ann x Late Santa Rosa)
18 Akihime Prunus salicina Japan 1991 CS
19 Beauty Prunus salicina USA unknown unknown
20 Redheart Prunus salicina USA 1943 Duarte x Wickson
21 Scarlet Prunus salicina Japan 1995 Taiyo OP
22 Jupiter Prunus salicina Japan unknown CS
23 Honey Red Prunus salicina Korea 2002 Oishiwase x Santa Rosa
24 Royal Oishiwase Prunus salicina Japan unknown Oishiwase OP
25 Kagayaki Prunus salicina Japan 1995 Taiyo OP
26 Tezaoshuli Prunus salicina China unknown unknown
27 Honey Rosa Prunus salicina Japan 1996 White Plum OP
28 Robusto Prunus salicina USA 1973 (Queen Ann x Barstow) x (Ozark Premier x P. angustifolia)
29 Hollywood P. pissardi x P. salicina USA 1932 Prunus interspecific crossing
30 La Crescent P. salicina x P. americana USA 1919 Shiro x Howard Yellow
31 White Plum P. salicina x P. simonii unknown unknown unknown
32 Methley P. salicina x P. cerasifera unknown unknown Prunus interspecific crossing
33 Superior Prunus salicina x (P. americana x P. simonii) USA 1925 Burbank x Kaga
34 Yellow Egg Prunus domestica unknown unknown unknown
35 Giant Damson Prunus insititia unknown unknown unknown
36 Mammoth Prunus americana USA unknown Domestic variety
37 Cocheco Prunus cerasifera unknown unknown unknown
38 Biocherry P. avium x P. domestica Japan unknown Prunus interspecific crossing

zOP : Open pollination

yCS : Chance seedling

Simple sequence repeat markers screened for identifying plum varieties and polymorphism of amplified markers.

Number of screened markers Type of SSR makers Polymorphism (%) of amplified SSR markers SSR marker source

35 Genomic SSR of Japanese plum 30/35 (85.7%) Mnejja et al. (2004)
6 Genomic SSR of Japanese plum EST-SSR of Almond Genomic SSR of Peach 4/6 (66.7%) Etehadpoor et al. (2012)
20 EST-SSR of Apricot 5/20 (25%) Shangguan et al. (2011)

61 39/61 (63.9%)

The effective 21 simple sequence repeat markers selected for identification of plum varieties.

No. Primer name Primer crop Primer source Repeat motif Forward primer Reverse primer Annealing temp. (°C) PCR product (bp) Number of alleles PIC

1 CPSCT002 Plum Mnejja et al. (2004) (CT)8 CATGTGCCTCAATGCATCTT CGGCCCACAAAATTGAACTA 55 149-155 4 0.655
2 CPSCT004z Plum Mnejja et al. (2004) (GA)8 GCTCTGAAGCTCTGCATTGA TTTGAAATGGCTATGGAGTACG 55 120-127 5 0.719
3 CPSCT012z Plum Mnejja et al. (2004) (GA)16 ACGGGAGACTTTCCCAGAAG CTTCTCGTTTCCTCCCTCCT 55 140-180 15 0.856
4 CPSCT018 Plum Mnejja et al. (2004) (CA)5(CT)20 AGGACATGTGGTCCAACCTC GGGTTCCCCGTTACTTTCAT 55 120-169 9 0.802
5 CPSCT021 Plum Mnejja et al. (2004) (GA)15 GCCACTTCGGCTAAAAGAGA TCCATATCTCCTCCTGCTTGA 55 122-163 10 0.675
6 CPSCT022 Plum Mnejja et al. (2004) (GA)13 TGTCTGCCTCTCATCTTAACCA TTCTTGAGCAGCCCATCTTCT 55 153-198 11 0.742
7 CPSCT024 Plum Mnejja et al. (2004) (GA)20 TGGGTCGTCTTCTTTATCGTG CCTCACCAAAACGGTAGTCAG 55 154-183 11 0.789
8 CPSCT025z Plum Mnejja et al. (2004) (CCT)3(CT)13 GCATTGCAAGCATTTGAAGA GATGCTATCCTTTCCGCATC 55 172-225 15 0.870
9 CPSCT026 Plum Mnejja et al. (2004) (CT)16 TCTCACACGCTTTCGTCAAC AAAAAGCCAAAAGGGGTTGT 55 166-210 12 0.814
10 CPSCT027z Plum Mnejja et al. (2004) (GA)23 CCCATGCTCCTGTGGTAAGT TTTAGAATCCCAACCCCACA 55 108-189 17 0.858
11 CPSCT029z Plum Mnejja et al. (2004) (GA)20 ATGGGCTAGAAGTGGTGGTG ATTCCGACTCGAAACGAAGA 55 139-163 7 0.688
12 CPSCT030 Plum Mnejja et al. (2004) (CT)12 CAACAGCGAGTGTCACGTTT AGGCAACGGACAAAAATCTG 55 139-218 14 0.828
13 CPSCT032z Plum Mnejja et al. (2004) (GA)10 CATCATCATCCTCACCCAAA TGCTGATCCGTGAGATCTTG 55 171-218 10 0.778
14 CPSCT034 Plum Mnejja et al. (2004) (CT)5GT(CT)6.. AGGTGGACAATAGCCGTGAT TTTCCAGACCCTGAGAAAGC 55 160-222 11 0.789
15 CPSCT039 Plum Mnejja et al. (2004) (GA)18 GCCGCAACTCGTAAGGAATA TCCACCGTTGATTACCCTTC 55 99-129 11 0.798
16 CPSCT041 Plum Mnejja et al. (2004) (GA)13 ACGATGCATGAAATCCATA TCTAACCAATCCCCCACATC 55 113-153 7 0.788
17 CPSCT042 Plum Mnejja et al. (2004) (GA)10 TGGCTCAAAAGCTCGTAGTG CCAACCTTTCGTTTCGTCTC 55 131-186 10 0.825
18 ASSR71 Almond Etehadpoor et al. (2012) (GA)15 AACTTTGTCTGCCTCTCATCTTA AGCAGCCCATTTCTTCTCTTG 55 157-179 9 0.691
19 BPPCT001 Peach Etehadpoor et al. (2012) (GA)27 AATTCCCAAAGGATGTGTATGAG CAGGTGAATGAGCCAAAGC 55 122-170 14 0.793
20 EST-SSR2 Apricot Shangguan et al. (2011) (AT)16 AGCTCGCAAACCCTGTAAAA GCTGGTCTGAGTTCGAGGAC 55 212-264 5 0.606
21 EST-SSR26 Apricot Shangguan et al. (2011) (CATCA)4 TCTACAGAGGGCGTTGAACC AAGGTTTCACCACAAGCCAC 55 87-111 3 0.549

Total 210 15.914
Mean 10.0 0.758

zMinimum markers

Table 1. The thirty-eight plum varieties used for construction of simple sequence repeat profile database.

OP : Open pollination

CS : Chance seedling

Table 2. Simple sequence repeat markers screened for identifying plum varieties and polymorphism of amplified markers.
Table 3. The effective 21 simple sequence repeat markers selected for identification of plum varieties.

Minimum markers