Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

밀크시슬(Silybum marianum (L.) Gaertner.)의 미토콘드리아 유전체 조립과 비교분석

Korean Journal of Breeding Science 2022;54(4):294-304.
Published online: December 1, 2022

1농촌진흥청 국립농업과학원 유전체과

2농업회사법인㈜이엘엔아이

3세종대학교 스마트생명산업융합학과

1Genomics Division, National Institute of Agricultural Sciences, RDA, 370 Nongsaengmyeong-ro, Jeonju, 54874, Republic of Korea

2EL&I, Co, Ltd., 17, Jangdoek-ri, Namyang-eup, Gyeonggi-do, Hwaseong, 18281, Republic of Korea

3Department of Integrative Biological Sciences and Industry, Sejong University, 209 Neungdong-ro, Seoul, 05006, Republic of Korea

*Corresponding Author: (E-mail: suyoung@korea.kr, Tel: +82-63-238-4563, Fax: +82-63-238-4554)
• Received: September 30, 2022   • Revised: October 26, 2022   • Accepted: November 4, 2022

Copyright © 2022 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 448 Views
  • 2 Download
  • 1 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • The genetics and genomics of milk thistle: unlocking its therapeutic potential through modern breeding and biotechnological innovations
    Priskila Tolangi, Jeehyoung Shim, Raña Mae Sumabat, Sunghan Kim, Hyun-Seung Park, Kyung Do Kim, Hyun Uk Kim, Sanghyun Lee, Joong Hyoun Chin
    Applied Biological Chemistry.2024;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

밀크시슬(Silybum marianum (L.) Gaertner.)의 미토콘드리아 유전체 조립과 비교분석
Korean. J. Breed. Sci.. 2022;54(4):294-304.   Published online December 1, 2022
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
밀크시슬(Silybum marianum (L.) Gaertner.)의 미토콘드리아 유전체 조립과 비교분석
Korean. J. Breed. Sci.. 2022;54(4):294-304.   Published online December 1, 2022
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
밀크시슬(Silybum marianum (L.) Gaertner.)의 미토콘드리아 유전체 조립과 비교분석
Image Image Image Image Image Image Image
Fig. 1 Circular map of the Silybum marianum mitogenome. The genomic features of both strands are drawn clockwise and counter-clockwise on the inside and outside of the circle, respectively. Different functional gene groups are color-coded, as indicated in the legend.
Fig. 2 Gene contents in the 12 Asteraceae and 4 outgroup mitogenomes. Twenty-seven common protein-coding genes were compared. Members of the Campanulaceae (NC_035958.1, Platycodon grandiflorus; NC_ 037949.1, Codonopsis lanceolata) and Solanaceae (NC_006581.1, Nicotiana tabacum; NC_035963.1, Solanum lycopersicum) families were used as the outgroups.
Fig. 3 Phylogenetic tree of Silybum marianum with other 11 Asteraceae and 4 outgroup plants. The tree was constructed based on the common protein-coding sequences. The numbers on the tree are bootstrap values.
Fig. 4 Capitulum morphologies of members of the Asteraceae family. Matricaria inodora capitula (A and B) and phyllaries and florets (C) (Zoulias et al. 2019). Inflorescences of Gerbera (D; Elomaa et al. 2018), Cirsium canescens Nutt. (E; Ackerfield et al. 2020), and Silybum marianum (L.) Gaertn. (genetic source: ‘912036’) (F). (G) ray floret. (H) Phyllary. (I) Disc floret.
Fig. 5 Comparison of simple-sequence repeats (SSRs) among the four indicated mitogenomes. Each column represents different repeat types. The numbers of repeats in each category are shown on the top of the corresponding columns.
Fig. 6 Sliding-window plot showing nucleotide differences as evaluated by determining the nucleotide diversity (Pi) for the indicated four mitogenomes. The X-axis shows the positions of mitogenomes in 50-kb increments, whereas the Y-axis shows Pi values. The color density reflects the corresponding Pi values, as indicated in the legend.
Fig. 7 The nucleotide-substitution rates (Ka: Ks ratios) of 20 common protein-coding genes for the indicated four mitogenomes. Each column in the heatmap represents Ka: Ks ratios determined by comparison with the Silybum marianum mitogenome. The color density of the heatmap reflects the Ka: Ks ration, as indicated in the legend.
밀크시슬(Silybum marianum (L.) Gaertner.)의 미토콘드리아 유전체 조립과 비교분석

Gene composition of the Silybum marianum mitogenome.

Group of genes Name of genes
ATP synthases atp1, atp4, atp6, atp8, atp9
Cytochrome c biogenesis ccmB, ccmFc, ccmFn
Cytochrome c oxidases cox1, cox2, cox3
NADH dehydrogenases nad1, nad2, nad3, nad4L, nad5 nad6, nad7
Large ribosomal subunits rpl5, rpl10, rpl16
Small ribosomal subunits rps3, rps4, rps12, rps13, rps14
Succinate dehydrogenase sdh4
Ribosomal RNAs rrn5, rrn18, rrn26
Transfer RNAs trnY-GUA, trnY-AUA, trnW-CCA, trnV-GAC, trnV-CAC, trnT-UGU, trnT-GGU, trnT-AGU, trnS-UGA, trnS-GGA, trnS-GCU, trnS-CGA, trnS-AGA, trnR-UCU, trnR-UCG, trnQ-UUG, trnQ-CUG, trnP-UGG, trnP-CGG, trnP-AGG, trnO-CUA, trnN-GUU, trnM-CAU, trnL-UAG, trnL-UAA, trnL-GAG, trnL-CAG, trnK-UUU, trnK-CUU, trnI-UAU, trnI-AAU, trnH-GUG, trnG-UCC, trnG-GCC, trnG-CCC, trnF-GAA, trnF-AAA, trnE-CUC, trnE-UUC, trnD-GUC, trnC-GCA, trnC-ACA, trnA-CGC, trnseC-UCA

Distributions of perfect tandem repeats.

Plant species No. Size (bp) Start Stop Repeat sequence (5'-3')
Silybum marianum (mitogenome used in this study) 1 27 41,104 41,157 GAAAAGGGTATGAAATAGGTTGCTTGT (×2)
2 25 81,380 81,429 TGAGAGATTCTATAGTTCCTGAGCT (×2)
3 21 101,162 101,205 AGGTAAAACAGTACGCCCACT (×2)
4 19 237,447 237,483 AACCAGGCAAATCTCTCTG (×2)
5 27 276,134 276,187 GAAAAGGGTATGAAATAGGTTGCTTGT (×2)
6 25 315,262 315,311 TGAGAGATTCTATAGTTCCTGAGCT (×2)
7 19 365,938 365,974 AACCAGGCAAATCTCTCTG (×2)
8 35 396,593 396,665 TTACTTCCTAGCCCCAGTGGGAGTAGTGACTAGCG (×2)
Arctium tomentosum (NC_0586431.1) 1 27 31,306 31,359 GAAAAGGGTATGAAATAGGTTGCTTGT (×2)
2 16 116,399 116,429 CTTGAATCTTATAGCA (×2)
3 25 160,161 160,210 AGCTCAGGAACTATAGAATCTCTCA (×2)
4 25 234,416 234,465 AGCTCAGGAACTATAGAATCTCTCA (×2)
Arctium lappa (NC_058644.1) 1 27 31,306 31,359 GAAAAGGGTATGAAATAGGTTGCTTGT (×2)
2 16 116,394 116,424 CTTGAATCTTATAGCA (×2)
3 25 160,156 160,205 AGCTCAGGAACTATAGAATCTCTCA (×2)
4 25 234,411 234,460 AGCTCAGGAACTATAGAATCTCTCA (×2)
Saussurea costus (NC_059793.1) 1 13 12,844 12,869 AGAATCTAAAATC (×2)
2 25 64,951 65,000 TGAGAGATTCTATAGTTCCTGAGCT (×2)
3 21 152,667 152,710 AGGTAAAACAGTACGCCCACT (×2)
4 20 205,751 205,791 GAATAAAGATAAGTACAAAA (×2)
5 21 272,092 272,153 CTATAAGATGCTAGCTGAAAT (×2)
6 21 285,818 285,879 TTTCAGCTAGCATCTTATAGA (×2)
7 25 306,355 306,404 AGCTCAGGAACTATAGAATCTCTCA (×2)
Table 1 Gene composition of the Silybum marianum mitogenome.
Table 2 Distributions of perfect tandem repeats.