Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

복숭아 ‘유명’ 유래 품종들에 대한 과실 성숙일수 구분 마커 개발

김정선1,*, 원소윤1, 박현우1, 김세희2

The Molecular Markers Associated with Fruit Development Period in ‘Yumyeong’ Peach Cultivars

Korean Journal of Breeding Science 2022;54(3):149-157.
Published online: September 1, 2022

1농촌진흥청 국립농업과학원 농업생명자원부 유전체과

2농촌진흥청 국립원예특작과학원 배연구소

1Genomics Division, Department of Agricultural Biotechnology, National Institute of Agricultural Sciences, Rural Development Administration, JeonJu, 54874, Republic of Korea

2Fruit Research Division, National Institute of Horticultural & Herbal Science, Rural Development Administration, Wanju-gun, 55365, Republic of Korea

*Corresponding Author (E-mail: jsnkim@korea.kr, Tel: +82-63-238-4559, Fax: +82-63-238-4552)
• Received: March 8, 2022   • Revised: June 29, 2022   • Accepted: July 4, 2022

Copyright © 2022 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 148 Views
  • 2 Download
next
  • Fruit development period (FDP), defined as the time between full bloom and maturity, varies greatly in peaches (Prunus persica L. Batsch). It is necessary to develop molecular markers associated with maturity date to extend the harvest season in new peach cultivars. We designed the 260 SSR primer set covering the entire genome of approximately 300 kb to 1 Mb based on P. persica cultivar ‘Mihong’ genome sequence. The SSR markers were used to survey the relationship between the parentages ‘Yumeyong’ and ‘Chiyomaru’ and their offspring cultivars ‘Mihong’, ‘Yumi’, ‘Misshong’ and ‘Soomee’. Male cultivar ‘Chiyomaru and its offspring cultivars ‘Mihong’, Yumi’, and ‘Misshong’ are early and middle maturity cultivars with FDP of 77, 76, 82, and 108 days, respectively, whereas female cultivar ‘Yumyeong’ and its offspring cultivar ‘Soomee’ are late maturity cultivars with FDP of 128 days. Three regions of SSR markers could distinguish between early, middle, and late maturity cultivars. In the early stages of breeding, these markers will be used for marker-assisted selection (MAS) in the parentages ‘Yumyeong’ and ‘Chiyomaru’ and their offspring cultivars.
복숭아(Prunus perscia L. Batsch)는 장미과에 속하며 장미과는 핵과 엽록체 loci 기반으로 Amygdaloideae, Rosoideae와 Dryadoideae 등 세 개의 그룹으로 분류된다(Potter et al. 2007). 복숭아는 자두, 체리, 살구, 아몬드와 함께 Amygdaloideae 아과(subfamily)에 속한다(Soundararajan et al. 2019). 복숭아는 사과와 배보다 유전적 변이가 적고 조기 결실 및 자가수정이 가능하여 초기부터 유전 양식에 대한 연구가 잘 이루어져 왔다(Monet et al. 1996). 복숭아는 실생선발과 변이선발에 의해 쉽게 육종이 되어서 개인 육종가의 활동이 많고 품종보호 등록된 품종수도 과수 작물 중 가장 많다(Hong et al. 2013).
복숭아는 작은 유전체(예측 크기, 265 Mb)를 가지고 있고, 장미과 원시조상(n=9) 으로부터 추가적인 Whole genome duplication (WGD) 없이 염색체의 융합 혹은 결실되는 과정을 통해 8개 염색체쌍을 가지고 있다(IPGI 2013, Verde et al. 2017). 이렇게 작고 중복이 없는 단순한 유전체의 서열로 인하여 국제 장미과 작물 게놈 프로젝트(http://www.rosaceae.org)에서 모델 작물로 이용되어 왔다. 유전학과 유전 다양성의 분석을 통해 계통 분류가 되어 왔고, 서로 다른 집단의 유전지도 작성과 비교유전지도 작성 및 양적유전자들의 분석으로 육종 선발에 이용할 수 있는 알레르기, 병 저항성, 나무 성장 특성, 자가불화합성등과 같은 형질들이 구명되었다(Aranzana et al. 2019). 이러한 유전형질 외에도, 최근에는 복숭아 과수의 환경 적응성에 대한 인자로서 저온 요구도가 낮은 품종개발, 수확기 확대 등이 육종가의 선호 형질이 되어가고 있다(Elsadr et al. 2019).
복숭아 과일의 성숙인자 관련 유전연구 동향을 살펴보면, 과일의 성숙인자 관련 QTL (Quantitative trait locus) 분석 결과, 개화일(bloom date, BD)은 연관군 1번 (172~182 cM), 연관군 4번(48~ 54 cM)과 연관군 7번(62~70 cM)에 위치하였고, 숙기(ripening date, RD)와 과일 성숙일수(fruit development period, FDP)는 연관군 4번(40~46 cM)에서 관련 표현형의 40~75%가 설명됨을 보고하였다(Rawandoozi et al. 2021). 과일성숙은 많은 과육색, 아로마, 향기 등 다양한 대사 조절들의 조화이다. 즉 과육 조직의 연화와 동시에 당도, 산도, 휘발성의 물질 축적이 과실 성숙 과정에서 일어난다(Pirona et al. 2013). 가을에 잎이 다 떨어지기까지 늦게까지 과실이 유지되는 복숭아 계통에 대한 연구가 되었고, 관련하는 단일 열성 유전자(Sr/sr)를 규명하였다. 이 유전자는 연관군 4번에 위치하였고 숙기(maturity date, MD) 후보 유전자(ppa008301m)로부터 개발된 SCAR 마커(RPS2)와 유사서열 NAC transcription factors들을 이용하여 복숭아 후대 육종에, 우선적 선발마커로 적용하였다(Eduardo et al. 2015). 이 들 숙기 유전자 영역을, 복숭아 게놈 v2.0 기준으로 Chr4, 11,111,981 bp에서 11,137,943 bp 영역에 있는 ppa008301m (ANAC072)과 ppa021959m (putative transposase)가 연구되었다. 이 영역을 증폭할 수 있는 PSR3 공우성 마커를 디자인하고 다양한 숙기를 보이는 집단에 적용하고, SR 표현형을 보이는(‘c’ 밴드) 늦은 숙기를 가지는 복숭아를 구분하였다(Meneses et al. 2016).
과실이 물러지는 기작으로, 성숙 동안에 IAA 생합성에 관여하는 YUCCA 유전자들이 경육종(stony hard) 표현형 후보유전자들이 보고되었다(Pan et al. 2015, Tatuski et al. 2018). 경육종 복숭아 ‘유명(Yumyeong)’과 경육종이 아닌 복숭아 ‘골드허니3 (Goldhoney 3)’ 에 대한 정량분석시, 경육종이 아닌 복숭아 ‘골드허니’ 과실 성장기에서 성숙기를 변화시키는 PpYUC11 유전자 발현이 높아짐을 보고하였다(Pan et al. 2015). 또한 경육종 복숭아와 아닌 복숭아간의 87개 계통의 맨하탄 분포(Manhattan plot)와 Quantile-Quantile plot (QQ) 분포에서 6번 염색체에 위치한 PpYUC11 유전자의 위치에서 성숙기 변화 형질에 관한 높은 유의수준을 제시하였다(Cirilli et al. 2018). 이러한 복숭아의 YUCCA 유전자군은 1번 염색체에 PpYUC1, 6, 두 개 유전자와 6번 염색체에 PpYUC11, 7번 염색체에 PpYUC7 및 8번 염색체에 네 개의 유전자인 PpYUC4, 8, 9, 10 이 위치함이 보고되었다(Pan et al. 2015).
복숭아 ‘유명’은 1977년 국내에서 육성된 품종으로 에틸렌이 합성되지 않아 단단한 과육이 장기간 유지되는 경육종 복숭아이다(Haji et al. 2001). 육종적으로는 저장성이 우수하여 품종 육성을 위한 모본으로 활용되고 있으며, 현재까지 ‘유명’에서 다수의 품종들이 선발되었으나, 이들 품종 사이의 유연 관계나 유전적 특성에 대한 연구는 부족한 실정이다(Song et al. 2021). 2000년부터 다양한 숙기를 가진 품종 육성을 위하여 극조생종 ‘미홍(Mihong)’ (Jun et al. 2007a), 조생종 ‘유미(Yumi)’ (Jun et al. 2013a), 중생종 ‘미스홍(Misshong)’ (Jun et al. 2013b) 만생종 ‘수미(Soomee)’ (Jun et al. 2007b) 품종을 개발하였다. 이러한 품종들은 모두 부드러운 과육을 가진 고품질 복숭아로 소비자의 선호도가 높아 재배면적이 증가하고 있지만 생산자 입장에서는 저장성이 다소 낮은 문제점을 안고 있다.
Next generation-sequencing (NGS) 기술의 발달은 많은 유전자원에 대하여 Single Sequence Repeats (SSRs), Single Nucleotide Polymorphisms (SNPs) 및 삽입/결손 변이, 목표로 하는 유전자 등 다양한 유전학적 재료들을 확보할 수 있게 하였다(Varshney et al. 2009). 딸기와 같이 육종 품종과 야생종간에 배수성이 다른 장미과 작물들은 참조(Reference) 유전체를 확보하는 것이 유전학적으로 육종연구에 매우 중요한 핵심이 되기도 한다(Isobe et al. 2020). 본 연구는 우리나라에서 복숭아 레퍼런스 유전체 서열을 분석하고 있는 ‘미홍’과 우량 품종으로 많이 재배되고 있는 ‘천중도백도(Kawanakajima Hakuto)’, ‘장호원황도(Changhowon Hwangdo)’와 ‘유미’ 복숭아들을 단거리 염기서열을 분석한 후, ‘미홍’ 유전체와 비교하여 다형성을 나타내는 SSRs을 분석하였다. 260개 SSR 프라이머를(Kim et al. 2021) 이용하여, 양친인 ‘유명’과 ‘찌요마루(Chiyomaru)’와 그 교잡계통 ‘미홍’, ‘유미’, ‘미스홍’과 ‘수미’ 복숭아의 다형성을 분석하였고, 숙기를 구분할 수 있는 세군 데 염색체에 위치하고 있는 8개 SSR 마커들을 개발하였다. 복숭아의 육종 목표는 점차 고당도 등 맛과 품질 중심으로 변화되고 있는데, 대부분의 복숭아는 저장성이 약하기 때문에 다양한 숙기의 품종이 요구되고 있다. 본 연구에서 개발한 복숭아 성숙일수를 구분할 수 있는 ‘유명’ 유래의 교배실생의 숙기를 구분한다면 원하는 숙기의 계통을 조기에 선발하여 육종효율을 높일 수 있을 것이다.
식물 재료
본 실험에서는 복숭아 ‘유명’과 ‘유명’을 모본으로 농촌진흥청 국립원예특작과학원에서 육종한 극조생종인 ‘미홍’(Jun et al. 2007a)과 조생종 ‘유미’(Jun et al. 2013a), 중생종인 ‘미스홍’(Jun et al. 2013b) 과 만생종인 ‘수미’(Jun et al. 2007b) 및 부본으로 사용한 ‘찌요마루’ 총 6개 품종을 이용하였다(Table 1).
식물 Genomic DNA 추출
식물재료 6개 품종들의 만개 후 20일 이내 어린잎을 채취하여 genomic DNA를 추출하였다. 액체질소를 이용하여 조직을 마쇄한 후, DNeasy Plant Mini Kit (Qiagen, Hilden, Germany)의 매뉴얼에 따라 genomic DNA를 추출하였다. 추출된 DNA는 1% agarose gel에서 전기영동하여 DNA를 확인하였고, Nanodrop 1000 Spectrophotometer (Thermo Scientific, MA, USA)를 이용하여 농도 및 순도를 확인하였다. 확인된 DNA는 1 µl당 4 ng의 농도로 희석하여 4 µl를 PCR 분석에 이용하였다.
PCR 및 전기영동 분석
Kim et al. (2021)이 보고한 260개 SSR 프라이머들을 이용하여, 복숭아 6개 품종(‘유명’, ‘찌요마루’, ‘미홍’, ‘유미’, ‘미스홍’, ‘수미’)을 PCR 분석하였다. PCR 분석은 16 ng genomic DNA와 10 pmol/µl의 양방향 프라이머와 멸균수로10 µl를 맞추고, 2배 농도의 TOPsimpleTMDyeMIX-nTaq (Taq DNA polymerase 0.2 U, dNTPs 0.4 mM, MgCl2 3 mM; Enzynomics, Daejeon, Korea)을 10 µl 넣어 반응액을 조제하였다. 반복 없이, 94℃에서 5분 동안 pre-denaturation을 수행한 뒤, 94℃에서 30초 denaturation, 60℃에서 30초 annealing, 72℃에서 1분 extension의 조건을 30회 반복하는 조건으로 수행하였다. 일부 primer의 경우 TM 값에 따라 온도를 조정하였다. PCR 산물은 2.5~3% agarose gel을 만든 후 1×TAE (Tris-Acetate EDTA) buffer내에서 80 V에서 3시간 동안 전기영동 하여 다양성을 탐색하였다.
숙기 연관 SSR 마커와 YUC 유전자군의 맵핑 비교 분석
복숭아 6종 PCR 분석에서, ‘유명’과 ‘수미’ 등 만숙종으로 구분하는 품종들과 조숙종인 ‘미홍’, ‘유미’, ‘찌요마루’와 중숙종 ‘미스홍’ 품종들간 차이를 보이는 마커 8종을 선발하였다. 이렇게 과실 성숙일 수와 연계된 마커들의 염색체 위치와 알려져 있는 경육종 복숭아의 물러짐에 관련하는 YUC 유전자군의 위치를 비교 분석하였다.
‘유명’ 모계와 ‘찌요마루’ 부계 복숭아 품종들의 숙기 특성
복숭아 품종군에서 경육종이 차지하는 비율은 매우 낮기 때문에 ‘유명’은 경육종 연구에서 활용되었다(Pan et al. 2015, Cirilli et al. 2018). 이 들 품종의 숙기와 양친 pedigree 등을 Table 1에 제시하였다. 부계로 이용한 ‘찌요마루’와 육성된 ‘미홍’, ‘유미’는 복숭아가 성숙일 수 각각 77, 76, 82일로 빠르게 결실되는 조생종으로 분류된다. ‘미스홍’은 성숙일 수가 108일로서 중생종에 속하고, 모계로 이용한 ‘유명’과 그 육성 계통 ‘수미’는 128일로서 만생종이다.
숙기가 다른 복숭아 품종간 다형성 분석
260개 SSR프라이머를 이용하여 6품종에 대해 다형성 분석을 실시한 결과는 Supplement Fig. 1과 같다. 260개 프라이머 중 PCR 증폭이 안된 프라이머는 19개, 6 품종 모두에서 다형성이 없는 SSR 마커는 49개이었다. 최소 한 개 품종 이상 다형성을 보인 마커는 192개로 73.8%의 다형성이 관찰되었다(Table 2).
성숙일수 구분 SSR 마커 탐색
여섯 개 품종에 대한 다형성이 있는 마커 192개 중에서 성숙일수를 구분할 수 있는 마커는 8개 이었다(Table 3). 프라이머 150번은 6번 염색체, 조립 스캐폴드 22번, 4,664,217 bp에서 4,664,252 bp 위치를 표지하고, 프라이머 151번은 6번 염색체, 동일 조립 스캐폴드 22번의, 4,774,584 bp에서 4,774,621 bp 유전영역에 대한 마커로서 같은 6번 염색체에 위치한 마커로 분석되었다(Table 3). 두번째 영역은, 7번 염색체에 위치한 프라이머 228번은 조립 스캐폴드 24번의, 14,764,107 bp에서 14,764,136 bp에 위치한 마커이고, 프라이머 230번은 조립 스캐폴드 24번의, 18,099,174 bp에서 18,099,239 bp 영역의 마커로서 물리적 거리가 좀 떨어져 있었다(Table 3). 7번 염색체의 229번 프라이머는 (스캐폴드 24번 17,599,472 bp 에서 17,599,497 bp), ‘미스홍’만 다른 다섯 픔종과 차이가 보였고, 숙기를 구별할 수 없는 것으로 나타났다(Supplement Fig. 1). 복숭아 숙기를 구별할 수 있는 마커 세번째 영역은 8번 염색체이었다. 프라이머 246번은 조립 스캐폴드 25번의 7,183,480 bp에서 7,183,513 bp를 표지하였고, 프라이머247번은 조립 스캐폴드 25번의 7,674,465 bp에서 7,674,498 bp 영역을, 프라이머249번은 조립 스캐폴드 25번의 7,831,800 bp에서 7,831,809 bp 영역을 탐침하는 마커 이었다. 이 들 영역에서 조금 떨어진 프라이머252번은 조립 스캐폴드 25번 9,980,615 bp에서 9,980,654 bp 영역을 표지하는 마커로서 복숭아 숙기를 구분할 수 있는 마커로 분석되었다(Table 3). 이 들 마커 사이에 위치한 프라이머 248번은 복숭아 여섯개 품종에 대하여 세가지 밴드 증폭 패턴을 보였고, 프라이머 250번은 복숭아 여섯개 품종에 대한 다형성이 나타나지 않았다. 프라이머 251번의 경우 여섯개 품종 증폭 패턴의 다형성이 나타났으나 숙기 선발과는 연관성이 뚜렷하지 않았다(Supplement Fig. 1).
경육종 복숭아 유래 숙기 유전자와 마커들에 대한 이해
복숭아 과실의 숙기와 밀접하게 연관된 주동 마커는 4번 염색체에 위치한다고 보고된 바 있다(Eduardo et al. 2015). 같은 Prunus속인 복숭아, 살구, 체리의 개화기 연관 주동마커의 위치를 살펴보면 살구와 체리는 연관군 4번에, 복숭아는 연관군1, 4, 6번에 보고하였고, 숙기 Quantitative trait locus (QTL)은 세 개 종 모두 연관군4번에 위치함이 보고되었다(Dirlewanger et al. 2012, Rawandoozi et al. 2021). 이는 ‘유명’이 만숙종에 해당되므로, 유명이 가지고 있는 특성인 물러김과의 관련성을 살펴볼 필요가 있는 것으로 사료된다. 본 연구에서 ‘유명’ 복숭아를 모계친으로 육성한 품종들의 성숙일 수 연관 마커들은 염색체 6, 7, 8번에서 탐색 되었다. 지금까지 알려진 과실의 숙기와는 다른 염색체에 맵핑되었는데 이는 만숙종의 유전 인자가 ‘유명’에서 유래됨을 보았을 때 경육종 복숭아의 물러짐을 살펴볼 필요가 있었다.
복숭아의 과실 성숙은 생화학적과 물리적인 환경 변화를 일으킨다. 즉 과실이 성숙하는 동안에, 과실 표면의 변화와 에틸렌 생성에 의해 높게 발현되는 유전자들이 있고, 호르몬이 조절되면서 과실이 물러지게 된다(Zhang et al. 2017). 기존 연구 결과를 고찰해 보면, 경육종 복숭아 ‘유명’의 옥신 항상성 조절하는 NAA 발현 연구로서 복숭아 YUCCA 옥신 생합성 유전자들이 구명되었다. PpYUC1, 2, 3, 4, 6, 8, 9, 10, 11 등의 유전체 위치와, 6번 염색체에 위치한 PpYUC11 유전자가 과실 성숙 발현에 관련이 있다고 보고된 바 있다. 또한 이러한 YUCCA 옥신 생합성 유전자들은 경육종 복숭아 ‘유명’의 물러짐과도 관련이 있다고 보고되었다(Pan et al. 2015). 이에 따라 복숭아 ‘미홍’ 조립 유전체의 PpYUC 유전자군의 유전체 위치를 맵핑한 결과는 Table 4와 같다.
숙기 구분 마커와 YUC 유전자군 비교 분석
본 연구에서 사용된 6개 품종에서 다형성을 보인 마커들의 대부분이 유전자지도 상에 맵핑되지 않았다. 이는 유전자지도 분리집단의 모본으로 이용된 ‘천중도백도’와는 다형성이 없기 때문에 나타난 결과로 추정된다. 그러나 모든 SSR 마커들은 ‘미홍’ 유전체 위치를 포함하는 마커 정보를 가지고 있기 때문에 비교되는 영역에 SSR 마커 위치와 YUC 유전자군의 위치를 비교 맵핑하였다. 복숭아 6번 염색체에는 PpYUC11 유전자가 16.2 Mb에 위치하였고, 과실 성숙일 수 관련 다형성을 보인 150번과 151번 SSR 마커의 위치는 4.66에서 4.77 Mb에 위치하였으며, 유전지도의 거리는 40 cM 정도 떨어져 있는 것으로 나타났다(Fig. 1).
7번 염색체에 위치한 과일 성숙일수 관련 SSR 마커들을 살펴보면, 미홍 복숭아 7번 염색체는 GBS SNPs 분리비가 많이 탐색되지 않은 염색체로서, 다형성이 예측된 SSR 마커가 많이 맵핑되지 않은 염색체이었다(Kim et al. 2021). PpYUC2 유전자는 2 Mb 영역에 위치하였고, 반면 숙기 탐색 SSR 마커들은 228번, 14.7 Mb과 230번, 18 Mb이었다. 프라이머 230번의 경우, 조생종인 ‘찌요마루’, ‘미홍’과 ‘유미’의 경우 4개 bands, 중생종인 ‘미스홍’은 2개 bands와 만생종인 ‘수미’ 와 ‘유명’은 3개 bands로서 과실 성숙일수 3개 타입 모두를 구분할 수 있는 마커로 조사되었다(Fig. 2).
‘유명’ 복숭아 유래 세번째 숙기 마커는 8번 염색체에서 탐색되었다. 8번 염색체에는 YUC 유전자가 네 카피나 위치되었는데, PpYUC9는 0.92 Mb, PpYUC8은 3.15 Mb, PpYUC4PpYUC 10은 21.2 Mb, 21.9 Mb에 각 각 분포하였다. 유전자지도에 맵핑된 SSR 마커들은 246번 프라이머(7.18 Mb), 247번 프라이머(7.67 Mb), 249번 프라이머(7.81 Mb)와 252번 프라이머(9.9 Mb) 이었다. 이와 같이 분석한 YUC 유전자군의 유전 영역과 숙기 마커 위치 및 복숭아 여섯개 품종에 대한 PCR 분석 결과는 Fig. 3과 같다.
복숭아는 실생변이 선발에 의해 새로운 품종이 많이 육성되어 개인 육종가의 활동이 많고 품종보호된 품종이 과수 중 가장 많다. 복숭아 육종의 트렌드가 고당도 등 맛과 품질 중심으로 변화되고 있기 때문에, 본 연구에서 선발된 8종의 SSR 마커를 이용하여 유묘기에 다양한 다양한 숙기를 우선적으로 선발하고 품질 선발 마커를 이용하여 육종한다면 보다 넓은 스펙트럼으로 우수 품종을 개발할 수 있을 것이다.
과일 성숙일수는 개화일로부터 과실이 무르익는 날까지의 기간이고 복숭아는 이 기간이 매우 다양하다. 육종의 다양성 확대를 위해서는 과일 성숙일수 관련된 분자마커 개발이 필요하다. 이에 따라 ‘미홍’ 복숭아의 유전체 서열을 기반하여 300 Kb에서 1 Mb 정도 떨어지도록 260개의 SSR 프라이머를 개발하였다. 만숙종 ‘유명’과 조숙종 ‘찌요마루’와 이의 교잡종 중에서 조숙종인 ‘미홍’, ‘유미’ 및 중숙종 ‘미스홍’ 그리고 만숙종 ‘수미’ 복숭아를 대상으로 다형성을 분석하였다. 본 연구에서 활용된 복숭아 품종들의 과일 성숙일수는 ‘찌요마루’ ‘미홍’. ‘유미’ 는 77, 76, 82일이고 ‘미스홍’은 108일, ‘유명’과 ‘수미’는 각 128일 정도이다. 복숭아 성숙일수가 다른 6개 품종에 대하여 260개의 SSR 프라이머를 이용하여 다형성을 분석한 결과 3군데 유전영역에 위치한 8개의 SSR 마커가 성숙일수를 구분할 수 있는 것으로 나타났다. 이러한 분자마커들은 육종 최기 단계에 다양한 숙기를 가진 품종을 육성하는데 활용이 될 수 있을 것으로 기대된다.
본문의 Supplementary Fig. 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.
본 연구는 농촌진흥청 국립농업과학원 농업기초기반연구(과제 번호: PJ016758012022)의 지원에 의하여 수행되었습니다.
Fig. 1
Genetic mapping of SSR markers related with maturity date and YUC11 gene location on Chr6 of Prunus persica. Blue letter indicated SSR markers. ‘M. 1 Kb ladder size marker; 1. ‘Chiyomaru’; 2. ‘Mihong’; 3. ‘Yumi’; 4. ‘Misshong’; 5. ‘Soomee’; 6. ‘Yumyeong’. EM is the early maturity and LM is the late maturity in the electrophoresis figures.
kjbs-54-3-149-f1.jpg
Fig. 2
Genetic mapping of SSR markers related with maturity date and YUC2 gene location on Chr7 of Prunus persica. Blue letter indicated SSR markers. M. 1 Kb ladder size marker; 1. ‘Chiyomaru’; 2. ‘Mihong’; 3. ‘Yumi’; 4. ‘Misshong’; 5. ‘Soomee’; 6. ‘Yumyeong’. EM is the early maturity, MM is the middle maturity and LM is the late maturity in the electrophoresis figures.
kjbs-54-3-149-f2.jpg
Fig. 3
Genetic mapping of SSR markers related with maturity date and YUC4, 8, 9, 10 genes location on Chr8 of Prunus persica. Blue letter indicated SSR markers. M. 1 Kb ladder size marker; 1. ‘Chiyomaru’; 2. ‘Mihong’; 3. ‘Yumi’; 4. ‘Misshong’; 5. . ‘Soomee’; 6. ‘Yumyeong’ EM is the early maturity and LM is the late maturity in the electrophoresis figures.
kjbs-54-3-149-f3.jpg
Table 1
Cultivar, fruit development period, origin, and pedigree characteristics of peach cultivars in this study.
Table 1
Accession Fruit development period (days) Origin Pedigree
Chiyomaru 77 Japan (Nakatsu Hakuto×Nunomewase)×Nunomewase
Mihong 76 Korea Yumyeong×Chiyomaru
Yumi 82 Korea Yumyeong×Chiyomaru
Misshong 108 Korea Yumyeong×Chiyomaru
Soomee 128 Korea Yumyeong×Chiyomaru
Yumyeong 128 Korea (Yannatowase×Nunomewase) or (Hakuto×Okayama 3)
Table 2
A PCR survey results on the six cultivars using 260 SSR markers of Prunus persica.
Table 2
PCR analysis in the six cultivars Number of SSR primers Ratio (%)
No amplicon 19 7.3
Monomorphic amplicon 49 18.85
Polymorphic at least in one cultivar 192 73.85
Total 260 100
Table 3
The characteristics of eight SSR related with FDP of Prunus persica.
Table 3
Chr No of Scaffolds SSR_marker SSR marker location Forward primer sequences Reverse primer sequences Product size (bp)
Chr6 Scaffold_22 #150 4,664,217 4,664,252 CGAAAGCCGACGAGAATAG GGAGAGCTTTAGAAGCACACAG 150
#151 4,774,584 4,774,621 GACCCCTTGCGCATATAA GCTCTCTATTTTCTGCTCCTCC 152
Chr7 Scaffold_24 #228 14,764,107 14,764,136 GTGGTTGTTTGAGTGTTGGG CACTTCGCTCATCTTCCTCTAC 183
#230 18,099,174 18,099,239 CCATTACAGCCTGGTGAAGA GAGTGTCTGGAATCGCAATG 162
Chr8 Scaffold_25 #246 7,183,480 7,183,513 GCGGTGGTTGTAGAGAATAGAG TCTTGGCCGACCTAATTG 196
#247 7,674,465 7,674,498 GGACCAAGTGGAACAGAGAA ACCTTAACCTAACCAGGGTCAC 176
#249 7,831,800 7,831,809 CTCAACCTCATGTCCTTTGC CTCATGGAGGGGAAGAAAGT 161
#252 9,980,615 9,980,654 AAGCTAACCTACTTGTCGTCCC GAGTTGGCCTTCAACTCTTC 194
Table 4
The genome location of YUC family genes in Prunus persica ‘Mihong (MH)’ cultivar.
Table 4
Gene Chr No of Scaffolds Genomic location
YUC1 Chr1 Scaffold_15 8,926,331 8,927,984
YUC6 Scaffold_15 9,861,805 9,864,449
YUC3 Scaffold_15 44,017,142 44,019,075
YUC11 Chr6 Scaffold_22 16,151,794 16,154,278
YUC2 Chr7 Scaffold_24 2,078,338 2,080,618
YUC9 Chr8 Scaffold_25 919,650 921,030
YUC8 Scaffold_25 3,154,436 3,156,032
YUC4 Scaffold_25 21,215,745 21,216,652
YUC10 Scaffold_25 21,935,134 21,937,256
  • 1. Aranzana MJ, Decroocq V, Dirlewanger E, Dduardo I, Gao ZS, Gasic K, Lezzoni A, Jung S, Peace C, Prieto H, Tao R, Verde I, Abbott AG, Arus P. 2019. Prunus genetics and applications after de novo genome sequencing: Achievements and prospects. Hort Res 6: 58
  • 2. Cirilli M, Glovannini D, Clacciulli A, Chiozzotto R, Gattolin S, Rossini L, Liverani A, Bassi D. 2018. Integrative genomics approaches validate PpYUC11-like as candidate gene for the stony hard trait in peach (P. persia L. Bastsch). BMC Plant Biol 18: 88
  • 3. Dirlewanger E, Quero-Garcia J, Le Dante Le L, Lambert P, Ruiz D, Dondini L, Illa E, Quilot-Turion B, Audergon JM, Tartarini S, Letourmy P, Arus P. 2012. Comparison of the genetic determinism of two key phenological traits, flowering and maturity dates, in three Punus species: Peach, apricot and sweet cherry. Heredity 109: 280-292.
  • 4. Eduardo I, Pican˜ol R, Rojas E, Batlle I, Howad W, Aranzana MJ, Aru's P. 2015. Mapping of a major gene for the slow ripening character in peach: Co-location with the maturity date gene and development of a candidate gene-based diagnostic marker for its selection. Euphytica 205: 627-636.
  • 5. Elsadr H, Sherif S, Banks T, Somers D, Jayasankar S. 2019. Refining the genomic region containing a major locus controlling furit maturity in peach. Sci Rep 9: 7522
  • 6. Haji T, Yaegaki H, Yamaguchi M. 2001. Changes in ethylene production and flesh firmness of melting, nonmelting and stony hard peaches after harvest. J Japan Soc Hort Sci 70: 458-459.
  • 7. Hong JH, Yi SI, Kwon YS, Kim Y, Choi KJ. 2013. Genetic diversity analysis of peach (Prunus Persica (L.) Batsch) varieties using SSR markers. Korean J Breed Sci 45: 201-211.
  • 8. Isobe S, Shirasawa K, Hirakawa H. 2020. Advances of whole genome sequencing in strawberry with NGS technologies. Hortic Res 89: 108-114.
  • 9. Jun JH, Chung KH, Kang SJ, Kwack YB, Son KJ, Hong KH, Jeong SB, Kim SJ, Yun IK, Park KS, Yun HK. 2007a. 'Mihong', an early maturing white peach. J Amer Pomol Soc 61: 19-20.
  • 10. Jun JH, Chung KH, Kang SJ, Kwack YB, Kim SJ, Yun IK. 2007b. A new late white-freshed peach cultivar, 'Soomee'. J Amer Pomol Soc 61: 21-22.
  • 11. Jun JH, Kwon JH, Nam EY, Chung KH, Yun IK, Yun SK, Kwack YB, Kim SJ, Kang SJ. 2013a. 'Yumi' peach. HortScience 48: 1416-1417.
  • 12. Jun JH, Nam EY, Chung KH, Yoon IK, Kwon JH, Kim SJ, Kwack Yb, Yun SK, Hwang HS. 2013b. A new mid- season peach cultivar 'Misshong'. J Amer Pomol Soc 67: 120-123.
  • 13. Kim JS, Ku YS, Pakr S-G, Kim SH, Park HW, Won SY. 2021. Anticipated polymorphic SSRs and their application based on next generation sequencing of Prunus persica. Korean J Breed Sci 53: 350-360.
  • 14. Meneses C, Ulloa-Zepead L, Cifurentes-Esquivel A, Infate R, Catin CM, Batlle I, Aru's P, Eduardo I. 2016. A codominat diagnostic marker for the slow ripening trait in peach. Mol Breeding 36: 77
  • 15. Monet R, Guye A, Roy M, Dachary N. 1996. Peach mendelian genetics: A short review and new results. Agronomie 16: 321-329.
  • 16. Pan L, Zeng W, Niu L, Lu Z, Liu H, Cui G, Zhu Y, Chu J, Li W, Fang W, Cai Z, Li G, Wang Z. 2015. PpYUC11, a strong candidate gene for the stony hard phenotype in peach (Prunus persica L. Batsch), participates in IAA biosynthesis during fruit ripening. J Exp Bot 66: 7031-7044.
  • 17. Pirona R, Edurado I, Pacheco I, Linge CDS, Miculan M, Verde I, Tartaini S, Dondini L, Pea G, Bassi D, Rossini L. 2013. Fine mapping and identification of a candidate gene for a majour locus controlling maturity date in peach. BMC Plant Biol 13: 166
  • 18. Potter D, Eriksson T, Evans RC, Oh S, Smedmark JEE, Morgan DR, Kerr M, Robertson KR, Aresenault M, Dickinson AD, Capphell CS. 2007. Phylogeny and classification of Rosaceae. PI Syst Evol 266: 5-43.
  • 19. Rawandoozi Z, Hartman T, Carpenedo S, Gasic K, Linge CS, Cai L, Weg EV, Byrne DH. 2021. Mapping and characterization QTLs for phenological traits in seven pedigree connected peach families. BMC Genom 22: 187
  • 20. Song SY, Lee JH, Hwang K, Jeong N, Choi IM, Kwon JH. 2021. Genomic relationship analysis by using FT-IR spectrum of genomic DNA from peach cultivars related to 'Yumyeong'. Hortic Sci Technol 39: 122-131.
  • 21. Soundararajan P, Won SY, Kim JS. 2019. Insight on Rosaceae family with genome sequencing and functional genomics perspective. Biomed Res Int 2019: 7519687.
  • 22. Tatsuki M, Soeno K, Shimada Y, Sawamura Y, Suesada Y, Yaegaki H, Sato A, Kakei Y, Nakamura A, Bai S, Moriguchi T, Nakajima N. 2018. Insertion of transposon-like sequence in the 5'-flanking region of the YUCCA gene causes the stony hard phenotype. Plant J 96: 815-827.
  • 23. IPGI (The International Peach Genome Initiative)2013. The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. Nat Genet 45: 487-496.
  • 24. Varshney RK, Nayak SN, May GD, Jackson SA. 2009. Next- generation sequencing technologies and their implications for crop genetics and breeding. Trends Biotechnol 27: 522-530.
  • 25. Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. 2017. The Peach v2.0 release: High-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC Genom 18: 225
  • 26. Zhang B, Peng B, Zhang C, Song Z, Ma R. 2017. Determination of fruit maturity and its prediction model based on the pericarp index of absorbance difference (/AD) for peaches. PLOS One 12: e0177511.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

The Molecular Markers Associated with Fruit Development Period in ‘Yumyeong’ Peach Cultivars
Korean. J. Breed. Sci.. 2022;54(3):149-157.   Published online September 1, 2022
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
The Molecular Markers Associated with Fruit Development Period in ‘Yumyeong’ Peach Cultivars
Korean. J. Breed. Sci.. 2022;54(3):149-157.   Published online September 1, 2022
Close

Figure

  • 0
  • 1
  • 2
The Molecular Markers Associated with Fruit Development Period in ‘Yumyeong’ Peach Cultivars
Image Image Image
Fig. 1 Genetic mapping of SSR markers related with maturity date and YUC11 gene location on Chr6 of Prunus persica. Blue letter indicated SSR markers. ‘M. 1 Kb ladder size marker; 1. ‘Chiyomaru’; 2. ‘Mihong’; 3. ‘Yumi’; 4. ‘Misshong’; 5. ‘Soomee’; 6. ‘Yumyeong’. EM is the early maturity and LM is the late maturity in the electrophoresis figures.
Fig. 2 Genetic mapping of SSR markers related with maturity date and YUC2 gene location on Chr7 of Prunus persica. Blue letter indicated SSR markers. M. 1 Kb ladder size marker; 1. ‘Chiyomaru’; 2. ‘Mihong’; 3. ‘Yumi’; 4. ‘Misshong’; 5. ‘Soomee’; 6. ‘Yumyeong’. EM is the early maturity, MM is the middle maturity and LM is the late maturity in the electrophoresis figures.
Fig. 3 Genetic mapping of SSR markers related with maturity date and YUC4, 8, 9, 10 genes location on Chr8 of Prunus persica. Blue letter indicated SSR markers. M. 1 Kb ladder size marker; 1. ‘Chiyomaru’; 2. ‘Mihong’; 3. ‘Yumi’; 4. ‘Misshong’; 5. . ‘Soomee’; 6. ‘Yumyeong’ EM is the early maturity and LM is the late maturity in the electrophoresis figures.
The Molecular Markers Associated with Fruit Development Period in ‘Yumyeong’ Peach Cultivars

Cultivar, fruit development period, origin, and pedigree characteristics of peach cultivars in this study.

Accession Fruit development period (days) Origin Pedigree
Chiyomaru 77 Japan (Nakatsu Hakuto×Nunomewase)×Nunomewase
Mihong 76 Korea Yumyeong×Chiyomaru
Yumi 82 Korea Yumyeong×Chiyomaru
Misshong 108 Korea Yumyeong×Chiyomaru
Soomee 128 Korea Yumyeong×Chiyomaru
Yumyeong 128 Korea (Yannatowase×Nunomewase) or (Hakuto×Okayama 3)

A PCR survey results on the six cultivars using 260 SSR markers of Prunus persica.

PCR analysis in the six cultivars Number of SSR primers Ratio (%)
No amplicon 19 7.3
Monomorphic amplicon 49 18.85
Polymorphic at least in one cultivar 192 73.85
Total 260 100

The characteristics of eight SSR related with FDP of Prunus persica.

Chr No of Scaffolds SSR_marker SSR marker location Forward primer sequences Reverse primer sequences Product size (bp)
Chr6 Scaffold_22 #150 4,664,217 4,664,252 CGAAAGCCGACGAGAATAG GGAGAGCTTTAGAAGCACACAG 150
#151 4,774,584 4,774,621 GACCCCTTGCGCATATAA GCTCTCTATTTTCTGCTCCTCC 152
Chr7 Scaffold_24 #228 14,764,107 14,764,136 GTGGTTGTTTGAGTGTTGGG CACTTCGCTCATCTTCCTCTAC 183
#230 18,099,174 18,099,239 CCATTACAGCCTGGTGAAGA GAGTGTCTGGAATCGCAATG 162
Chr8 Scaffold_25 #246 7,183,480 7,183,513 GCGGTGGTTGTAGAGAATAGAG TCTTGGCCGACCTAATTG 196
#247 7,674,465 7,674,498 GGACCAAGTGGAACAGAGAA ACCTTAACCTAACCAGGGTCAC 176
#249 7,831,800 7,831,809 CTCAACCTCATGTCCTTTGC CTCATGGAGGGGAAGAAAGT 161
#252 9,980,615 9,980,654 AAGCTAACCTACTTGTCGTCCC GAGTTGGCCTTCAACTCTTC 194

The genome location of YUC family genes in Prunus persica ‘Mihong (MH)’ cultivar.

Gene Chr No of Scaffolds Genomic location
YUC1 Chr1 Scaffold_15 8,926,331 8,927,984
YUC6 Scaffold_15 9,861,805 9,864,449
YUC3 Scaffold_15 44,017,142 44,019,075
YUC11 Chr6 Scaffold_22 16,151,794 16,154,278
YUC2 Chr7 Scaffold_24 2,078,338 2,080,618
YUC9 Chr8 Scaffold_25 919,650 921,030
YUC8 Scaffold_25 3,154,436 3,156,032
YUC4 Scaffold_25 21,215,745 21,216,652
YUC10 Scaffold_25 21,935,134 21,937,256
Table 1 Cultivar, fruit development period, origin, and pedigree characteristics of peach cultivars in this study.
Table 2 A PCR survey results on the six cultivars using 260 SSR markers of Prunus persica.
Table 3 The characteristics of eight SSR related with FDP of Prunus persica.
Table 4 The genome location of YUC family genes in Prunus persica ‘Mihong (MH)’ cultivar.