Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

저항성 유전자 도입과 벼 후대계통의 열악형질간의 관계분석

이창민1, 박현수1, 백만기1, 서정필1, 정오영1, 윤성중2, 김석만1,3,*

Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross

Korean Journal of Breeding Science 2021;53(4):392-403.
Published online: December 1, 2021

1농촌진흥청 국립식량과학원 작물육종과

2전북대학교 작물생명과학과

3경북대학교 생태환경시스템학부

1Department of Crop Breeding, National Institute of Crop Science (NICS), Rural Development Administration (RDA), Wanju, 55365, Republic of Korea

2Department of Crop Science & Biotechnology, Jeonbuk National University, Jeonju, 54896, Republic of Korea

3Department of Ecological & Environmental system, Kyungpook National University, Sangju, 37224, Republic of Korea

*Corresponding Author (E-mail: s_kim@knu.ac.kr, Tel: +82-54-530-1206, Fax: +82-54-530-1209)
• Received: September 13, 2021   • Revised: November 11, 2021   • Accepted: November 11, 2021

Copyright © 2021 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 133 Views
  • 2 Download
  • 1 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Association Analysis of Yield-Related Traits in Rice Following the Introduction of Brown Planthopper Resistant Genes
    Jae-Ryoung Park, Jeonghwan Seo, Chang-Min Lee, Songhee Park, Mina Jin, Keon Mi Lee, O-Young Jeong, Jung-Pil Suh, Hyun-Su Park
    Korean Journal of Breeding Science.2024; 56(4): 381.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross
Korean. J. Breed. Sci.. 2021;53(4):392-403.   Published online December 1, 2021
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross
Korean. J. Breed. Sci.. 2021;53(4):392-403.   Published online December 1, 2021
Close

Figure

  • 0
  • 1
  • 2
  • 3
Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross
Image Image Image Image
Fig. 1 Procedures of development of the recombinant inbred lines from a cross of Jinbubyeo and GPL-40 (SR32816(1)-40-2-B). ABL1, ABL2, and ABL3 (BC3F6) plants are R-genes introgression lines with the genetic background of Jinbubyeo.
Fig. 2 Histogram of tested traits in the RILs. P1 is Jinbubyeo, and P2 is GPL-40. DTH: days to heading, CL: culm length (cm), PL: panicle length (cm), NP: number of panicle per hills, NS: number of spikelet per panicle, Yield: Rough yield of 3hills (g), TGW: Rough rice 1,000 grain weight (g), SF: spikelet fertility (%), RRG: ratio of ripened grain (%), Protein: content of protein (%), Amylose: content of amylose (%), PE: panicle extraction (cm), TIL: third internode length (cm), FLA: flag leaf angle degree (1:Erect-9:Horizontal).
Fig. 3 Correlation analysis between R-genes and the five traits negatively affected. DTH: days to heading, CL: culm length, PL: panicle length, NP: number of panicle per hills, NS: number of spikelet per panicle, RRG: ratio of ripened grain, SF: spikelet fertility, TIL: Third internode length, PE: panicle extraction, Pro: content of protein. Significance levels: *p<0.05, **p<0.001 and ***p<0.0001.
Fig. 4 Location of QTLs for traits negatively affected identified on the linkage map for six rice chromosomes.
Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross

List of DNA markers used for validation of bacterial blight, blast, BPH resistance genes

R-genes Chr. No.z Marker name Primer sequences used for gene detection Exp. Size (bp) Enzyme Band type Reference
Forward (5'-3') Reverse (5'-3')
Xa4 11 10571.T14 TGTTGGAGGATTGGCAAGGAA TTCGTTGCGGCGTTGTTAATC 570 Tsp 509I Co-dominant Park et al. 2012
xa5 5 10603.T10Dw GCA CTG CAA CCA TCA ATG AAT C CCT AGG AGA AAC TAG CCG TCC A 280 Rsa I Co-dominant Park et al. 2012
Xa21 11 U1+I1 CGA TCG GTA TAA CAG CAA AAC ATA GCA ACT GAT TGC TTG G 1,400 None Co-dominant Park et al. 2012
Pi40 6 9871.T7E2b CAA CAA ACG GGT CGA CAA AGG CCC CCA GGT CGT GAT ACC TTC 642 Tsp 509I Co-dominant Jeung et al. 2007
Bph18 12 7312.T4A ACG GCG GTG AGC ATT GG TAC AGC GAA AAG CAT AAA GAG TC 1,078 Hinf I Co-dominant Jena et al. 2006

Distribution of Kompetitive allele specific PCR (KASP) markers on 12 rice chromosomes exhibiting polymorphisms by the parental survey

Chr. No.z No. of markers No. of Polymorphic markersy % of Polymorphismx No. of selected markers using QTL analysis Interval (cM)w Chr. Length (cM)v
1 102 30 29 14 8.57 111.45
2 66 0 0 - - -
3 48 8 17 7 20.55 123.33
4 60 13 22 9 9.25 73.99
5 63 23 37 12 8.91 98.09
6 61 15 25 12 12.26 134.89
7 68 15 22 9 9.40 75.17
8 67 16 24 14 4.11 53.49
9 64 20 31 12 3.15 34.66
10 44 16 36 7 10.97 65.82
11 74 30 41 21 4.66 93.17
12 54 10 19 10 3.07 27.65
Total (Average) 771 196 (25) 127 (8.63) (30)

Agronomic traits of Jinbubyeo, GPL-40 and RILs.

Cultivar/breeding line Agronomic traitsz
DTH CL PL NP NS Yield TGW SF RRG Protein Amylose PE TIL FLA
Jinbubyeo 97.5 73.3 18.9 8.7 83.7 60.4 27.7 95.8 87.7 7.6 18.5 5.4 14.5 3
GPL-40 105.5 89.8 19.4 9.6 87.5 48.3 25.0 75.2 71.6 7.8 20.0 7.4 17.0 1
RILs 98.6 78.3 19.2 11.3 111.5 60.3 26.8 72.2 60.6 8.1 17.1 5.1 15.7 3
Range 90.5~106.0 60.5-104.2 16.1~23.2 7.5~14.6 67.9-176.5 14.7~106.6 22.5~31.2 15.5~97.6 10.0~91.4 5.9~11.2 7.5~26.4 1~9 6.7~20.8 1~9

ANOVA analysis between trait groups tested and five resistance genes

Group Trait Resistance genes
Xa4 xa5 Xa21 Pi40 Bph18
Main DTHz 0.23ns 0.01ns 1.60ns 0.90ns 1.12ns
CL 0.33ns 1.31ns 0.01ns 12.59** 28.11**
PL 0.01ns 0.70ns 0.54ns 31.72** 8.61**
NP 2.68ns 0.06ns 2.15ns 0.98ns 0.02ns
Yield NS 0.00ns 16.50** 7.04** 34.92** 2.94ns
Yield 7.32** 1.63ns 5.78* 19.03** 12.07**
TGW 1.70ns 0.26ns 6.23ns 5.03ns 0.02ns
SF 11.39** 0.15ns 2.90ns 5.80* 32.86**
Grain quality RRG 7.86** 0.08ns 0.68ns 1.61 27.49**
Pro 6.66* 0.18ns 1.81ns 16.45** 7.30**
Amy 0.20ns 0.12ns 0.04ns 4.89* 6.23*
Morphological PE 0.02ns 4.92* 0.02ns 5.00* 22.75**
TIL 4.53* 1.71ns 5.92* 2.28ns 27.00**
FLA 3.35ns 0.46ns 1.49ns 0.00ns 0.17ns

ANOVA test of five R-genes and their interactions on traits associated with rice poor characters.

RRG SF TIL PE Pro
SSz F value PVE SS F value PVE SS F value PVE SS F value PVE SS F value PVE
Pi40 727 1.8ns 0.7 3448 6.1* 2.2 9.1 1.6 0.6ns 12.7 4.5* 1.8 17.2 16.6** 6.8
Bph18 11818 29.1** 11.3 20270 35.6** 13.0 145.2 25.3 9.8** 61 21.6** 8.7 8.6 8.3** 3.4
Xa4 2612 6.4* 2.5 5287 9.3* 3.4 21.8 3.8 1.5ns 0 0.0ns 0.0 5.6 5.4* 2.2
Pi40+Bph18 557 1.4ns 0.5 1123 2.0ns 0.7 13.7 2.4 0.9ns 1 0.4ns 0.1 4.1 4.0* 1.6
Pi40+Xa4 18 0.0ns 0.0 2 0.0ns 0.0 0.5 0.1 0.0ns 0.1 0.0ns 0.0 0.0 0.0ns 0.0
Bph18+Xa4 181 0.4ns 0.2 1595 2.8ns 1.0 2.5 0.4 0.2ns 0.1 0.1ns 0.0 0.6 0.6ns 0.2
Pi40+Bph18+Xa4 265 0.7ns 0.3 4 0.0ns 0.0 39.4 6.9* 2.7ns 16.1 5.7* 2.3 1.0 0.9ns 0.4

Comparison of lines with traits associated with rice poor characters according to two gene Pi40 and Bph18 in the population

Resistant gene No. of lines RRG (%)z SF (%) TIL (cm) PE (cm) Pro (%)
Pi40 72 63.2by 78.0b 16.0a 5.5a 7.7b
pi40 151 59.3c 69.4c 15.6a 5.0a 8.3a
Bph18 168 56.6c 67.0c 16.2a 5.5a 8.2a
bph18 55 72.7a 88.0a 14.3b 4.2b 7.8b
Jinbubyeo (P1) 1 87.7a 95.8a 14.5b 5.4b 7.6b
GPL-40 (P2) 1 71.6b 75.2b 17.0a 7.4a 7.8a

QTLs identified for tested traits in the RIL population.

QTLz Chromosome Left-Marker Position (Mp) Right-Marker Position (Mp) LOD PVE (%)y Addx
qRRG 8 KJ08_037 8.85 KJ08_038 9.00 6.0 7.7 -6.5
11 KJ11_016 5.68 KJ11_017 5.93 3.1 3.9 5.2
12 KJ12_059 23.26 KJ12_061 25.29 17.3 25.7 13.0
qSF 8 KJ08_040 9.49 KJ08_070 16.44 9.1 11.9 -9.6
11 KJ11_013 5.01 KJ11_015 5.56 8.2 10.1 9.8
12 KJ12_059 23.26 KJ12_061 25.29 19.0 23.1 16.2
qPE 1 KJ01_105 35.19 KJ01_116 39.81 7.0 13.5 0.7
6 KJ06_045 12.99 KJ06_055 15.20 3.6 4.7 -0.4
12 7312.T4A (Bph18) 22.89 KJ12_059 23.26 5.8 7.5 -0.6
qTIL 1 KJ01_105 35.19 KJ01_116 39.81 14.4 20.5 1.3
3 KJ03_015 4.43 KJ03_016 4.79 5.4 5.1 -0.7
6 KJ06_045 12.99 KJ06_055 15.20 4.5 4.1 -0.6
11 KJ11_092 23.75 KJ11_099 27.58 6.3 6.4 -0.8
12 KJ12_058 22.48 7312.T4A (Bph18) 22.89 9.1 8.9 -1.0
qPro 8 KJ08_038 9.00 KJ08_040 9.49 8.2 11.5 0.4
11 KJ11_013 5.01 KJ11_015 5.56 5.0 6.9 -0.3
12 KJ12_059 23.26 KJ12_061 25.29 11.3 16.7 -0.5
Table 1 List of DNA markers used for validation of bacterial blight, blast, BPH resistance genes

zChromosome number

Table 2 Distribution of Kompetitive allele specific PCR (KASP) markers on 12 rice chromosomes exhibiting polymorphisms by the parental survey

zChromosome number

yNumber of polymorphic markers between Jinbubyeo and GPL-40

xPercentage of polymorphism between Jinbubyeo and GPL-40

wAverage marker interval (cM)

vChromosome length in centimorgan (cM)

Table 3 Agronomic traits of Jinbubyeo, GPL-40 and RILs.

zDTH: days to heading, CL: culm length (cm), PL: panicle length (cm), NP: number of panicle per hills, NS: number of spikelet per panicle, Yield: Rough yield of 3hills (g), TGW: Rough rice 1,000 grain weight (g), SF: spikelet fertility (%), RRG: ratio of ripened grain (%), Protein: content of protein (%), Amylose: content of amylose (%), PE: panicle extraction (cm), TIL: third internode length (cm), FLA: flag leaf angle degree(1:Erect-9:Horizontal).

Table 4 ANOVA analysis between trait groups tested and five resistance genes

zDTH: days to heading, CL: culm length, PL: panicle length, NP: number of panicle per hills, NS: number of spikelet per panicle, Yield: Rough yield of 3hills, TGW: Rough rice 1,000 grain weight, SF: spikelet fertility, RRG: ratio of ripened grain, Pro: content of protein, Amy: content of amylose, FLA: flag leaf angle degree, PE: panicle extraction, TIL: third internode length.

nsnot significant

Significance levels: *p<0.05 and **p<0.001.

Table 5 ANOVA test of five R-genes and their interactions on traits associated with rice poor characters.

zSS: sum of squares, PVE: proportion of variance explained, RRG: ratio of ripened grain, SF: spikelet fertility, TIL: third internode length, PE: panicle extraction, Pro: content of protein.

nsnot significant

Significance levels: *p<0.05 and **p<0.001.

Table 6 Comparison of lines with traits associated with rice poor characters according to two gene Pi40 and Bph18 in the population

zRRG: ratio of ripened grain, SF: spikelet fertility, TIL: Third internode length, PE: panicle extraction, Pro: content of protein.

yMeans with same letters in a column are not significant at p<0.05 (ANOVA followed by DMRT).

Table 7 QTLs identified for tested traits in the RIL population.

zRRG: ratio of ripened grain, SF: spikelet fertility, TIL: Third internode length, PE: panicle extraction, Pro: content of protein

yPVE (%): percentage of phenotypic variation explained by the QTL

xAdd: additive effect