Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

엽록체 trnL-trnF intergenic spacers (IGS) 영역과 핵 리보솜 Internal Transcribed Spacer (ITS) 영역 염기서열을 이용한 제주도 내 ‘인창귤’(‘Inchangkyool’)과 중국 의창지( ‘Ichangensis’) 품종과의 유전학적 분석

김민주, 김미선, 신기혜, 박석만, 최철우, 윤수현, 진성범*

Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions

Korean Journal of Breeding Science 2021;53(1):16-31.
Published online: March 1, 2021

농촌진흥청 국립원예특작과학원 감귤연구소

Citrus Research Institute, National Institute of Horticultural & Herbal Science, RDA, Jeju 63613, Republic of Korea

* Corresponding Author (E-mail: pfad7@naver.com, Tel: +82-64-730-4146, Fax: +82-64-733-9564)

Copyright © 2021 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 339 Views
  • 0 Download
  • 2 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Effects of Citrus (Citrus spp.) Genotype and Carbohydrate Source Composition on Callus Growth and Somatic Embryogenesis and Recovery of the Plant Regeneration Ability
    Seong Beom Jin, Dong Hoon Lee, Suk Man Park, Young Eel Moon, Jee-Soo Park
    Plant Breeding and Biotechnology.2026;[Epub]     CrossRef
  • Anther Culture-Derived Haploids of Citrus aurantium L. (Sour Orange) and Genetic Verification of Haploid-Derived Regenerated Plants
    Seong Beom Jin, Min Ju Kim, Cheol Woo Choi, Suk Man Park, Su Hyun Yun
    Plants.2022; 11(22): 3022.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions
Korean. J. Breed. Sci.. 2021;53(1):16-31.   Published online March 1, 2021
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions
Korean. J. Breed. Sci.. 2021;53(1):16-31.   Published online March 1, 2021
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions
Image Image Image Image Image
Fig. 1 Morphological feature of and Citrus ichangenesis ‘Ichangensis’ in China (A) and ‘Inchangkyul’ in Jeju island (B).
Fig. 2 PCR amplification using the chloroplast trnL-trnF spacer region and nuclear internal transcribed spacer regions of 30 Citrus cultivars (A and D). Polyacrylamide gel electrophoresis using the QiAxcel Advanced System (Qiagen); A: PCR fragment using chloroplast trnL-trnF primer set, B: PCR fragment using ITS1 primer set, C: PCR fragment using ITS2 primer set, D: PCR fragment using total ITS (ITS1 + 5.8S rDNA + ITS2) region primer set; A1: molecular marker (20 bp and 100 bp DNA ladder, Qiagen); A2: ‘Sativa you’; A3: ‘Tavares’; A4: ‘Wilking’; A5: ‘Haryejosaeng’; A6: ‘Shiranuhi’; A7: ‘Ovale Kumquat’; A8: ‘Marsh’; A9: ‘Shinyegam’; A10; ‘Trifoliate orange’ A11: ‘Iwasaki wase’; A12: ‘Myagawa wase’; B1: ‘Tamnanuenbong’; B2: ‘Cook Eureka’; B3: ‘Cheongkyool’; B4: ‘Dangyooja’; B5: ‘Jinkyool’; B6: ‘Pyunkyool’; B7: ‘Dongjeongkyool’; B8: ‘Kamja’; B9: ‘Jikak’; B10: ‘Yuzu’; B11: ‘Binkyool’; B12: ‘Hongkyool’; C1: ‘Byungkyool’; C2: ‘Nova’; C3: ‘Washington navel’; C4: ‘Hamlin’; C5: ‘Kiyomi’; C6: ‘Inchangkyul’; C7: ‘Ichangensis’.
Fig. 3 Nucleotide sequences of the ITS and chloroplast trnL-trnF regions. Citrus inchangenesis ‘Ichangensis’ ITS rDNA region A); ‘Inchangkyul’ ITS rDNA region B); Citrus inchangenesis ‘Ichangensis’ chloroplast including trnL-trnF intergenic spacers regions C); ‘Inchangkyul’ chloroplast including trnL-trnF intergenic spacers regions D). Citrus inchangenesis ‘Ichangensis’ and ‘Inchangkyul’ was harvested in Jeju Native Citrus Research. Box indicates the primer sites used for sequence analysis.
Fig. 4 Phylogenic tree about total 30 genotypes including 11 of Jeju native cultivars, Citrus inchangenesis ‘Ichangensis’ and ‘Inchankgyul’ and 17 genotypes of Citrus containing Poncirus and Fortunellar obtained from chloroplast trnL-trnF intergenic spacers (IGS) region sequence data by Maxium Likelihood (ML.). The red dotted line indicates ‘Inchankgyul’,the red box indicates Citrus ichangenesis ‘Ichangensis’.
Fig. 5 Phylogenic tree about total 31 genotypes including 11 of Jeju native cultivars,.Citrus inchangenesis ‘Ichangensis’ and ‘Inchankgyul’, putative ‘Inchankgyul’ (Accession No. JQ990182), and 17 genotypes of Citrus containing Poncirus and Fortunellar obtained from chloroplast ITS (ITS1, 5.8S rDNA, ITS2, ITS1+5.8S rDNA+ ITS2) region sequence data by Maxium Likelihood (ML.): Phylogenic tree constructed using sequences of the ITS1 region (A); Phylogenic tree constructed using sequences of the 5.8S rDNA region (B); Phylogenic tree constructed using sequences of the ITS2 region (C); Phylogenic tree constructed using sequences of the total ITS (ITS1+5.8S rDNA+ ITS2) region (D). The blue box indicates putative ‘Inchankgyul’ (Accession No. JQ990182), The red box indicates ‘Inchankgyul’, The red dotted line indicates Citrus ichangenesis ‘Ichangensis’.
Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions

List of 30 Citrus cultivars used in this study and their numbers.

No. Cultivar trnL-F region ITS region

Common name Scientific name accession number accession number
1 ‘Sativa you’ pomelo Citrus grandis (L.) Osbeck grp 7848271z MG702205
2 ‘Tavares’ lime Citrus aurantifolia × Fortunella margarita grp 7848271 MG702227
3 ‘Wilking’ mandarin Citrus reticulata grp 7848271 MG702212
4 ‘Haryejosaeng’ Citrus unshiu Marc. grp 7848271 MG702222
5 ‘Shiranuhi’ (Citrus unshiu × Citrus sinensis) × Citrus reticulata grp 7848271 MG702207
6 ‘Ovale Kumquat’ Citrus japonica var. margarita grp 7848271 MG702225
7 ‘Marsh’ grapefruit Citrus paradisi grp 7848271 MG702214
8 ‘Shinyegam’ (Citrus unshiu × Citrus sinensis) × Citrus Citrus reticulata grp 7848271 MG702209
9 ‘Trifoliate orange’ Citrus trifoliata grp 7848271 MG702226
10 ‘Iwasaki wase’ Citrus unshiu Marc. grp 7848271 MG702210
11 ‘Myagawa wase’ Citrus unshiu Marc. grp 7848271 MG702201
12 ‘Tamnanuenbong’ Citrus reticulata grp 7848271 MG702220
13 ‘Cook Eureka’ lemon Citrus limon L. Burm.f. grp 7848271 MG702204
14 ‘Cheongkyool’ Citrus nippokoreana grp 7848271 MG702219
15 ‘Dangyooja’ Citrus grandis Osbeck grp 7848271 MG702202
16 ‘Jinkyool’ Citrus sunki Hort. ex Tanaka grp 7848271 MG702217
17 ‘Pyunkyool’ Citrus tangerina Hort. ex Tanaka grp 7848271 MG702221
18 ‘Dongjeongkyool’ Citrus erythrosa Hort. et Tanaka grp 7848271 MG702203
19 ‘Kamja’ Citrus benikoji Hort. ex. Tanaka grp 7848271 MG702199
20 ‘Jikak’ Citrus aurantium L. grp 7848271 MG702216
21 ‘Yuzu’ Citrus junos Sieb. ex Tanaka grp 7848271 MG702198
22 ‘Binkyool’ Citrus leiocarpa grp 7848271 MG702208
23 ‘Hongkyool’ Citrus tachibana Tanaka grp 7848271 MG702224
24 ‘Byungkyool’ Citrus platymamma Hort. et Tanaka grp 7848271 MG702206
25 ‘Nova’ mandarin Citrus reticulata grp 7848271 MG702200
26 ‘Washington navel’ orange Citrus sinensis grp 7848271 MG702211
27 ‘Hamlin’ sweet orange Citrus sinensis grp 7848271 MG702253
28 ‘Kiyomi’ tangor Citrus reticulata grp 7848271 MG702218
29 ‘ Inchangkyul’ - grp 7848271 MG702215
30 ‘Ichangensis’ Citrus ichangenesis grp 7848271 MG702213

zNumber submitted to Genbank

Primer sets used for the amplification of chloroplast trnL-trnF and nuclear ribosomal DNA ITS regions.

No. Amplification region Primer name Primer sequence (5'->3') Length Tmz (℃) GC (%)
1 trnL-trnF trnL-F AAAATCGTGAGGGTTCAAGTC 21 53 42.9
trnF-R GATTTGAACTGGTGACACGAG 21 53.7 47.6
2 ITS1 ITS1F GAAGGATCATTGTCGACCTGCCAGCAGACG 30 65.2 56.7
ITS1R GAGAGTCGTTTTGGATACATGTGAAAGAAG 30 57.5 40.0
3 ITS2 ITS2F CTGCCTGGGTGTCACGCATCGTTGCCCCAC 30 70.6 66.7
ITS2R GACCTGGGGTCGCAATGCGAGCGCCGCTT 29 72.4 69.0
4 ITS (ITS1+5.8S rDNA +ITS2) ITS1F GAAGGATCATTGTCGACCTGCCAGCAGACG 30 65.2 56.7
ITS2R GACCTGGGGTCGCAATGCGAGCGCCGCTT 29 72.4 69.0

zTM value: https://sg.idtdna.com/calc/analyzer

Sequence length and G+C content (%) of the trnL-trnF intergenic spacers and ITS region genes and comparison between Citrus inchangenesis ‘Ichangensis’ and ‘Inchangkyul’ cultivars.

Cutivar Sequence length (bp) G+C content (%)

trnL-trnF intergeinc spacers ITS1 5.8S ITS2 ITS (ITS1-5.8S-ITS2) trnL-trnF intergeinc spacers ITS1 5.8S ITS2 ITS (ITS1-5.8S-ITS2)
Citrus ichangenesis ‘Ichangensis’z 373 247 163 228 638 36.73 71.26 54.6 70.61 65.49
‘Inchangkyul’y 373 248 163 226 637 36.73 70.16 54.6 69.03 64.6

zIt is Citrus ichangensis harvested in Citrus Research Institute.

y‘Inchangkyul’ cultivar using in this study was harvested in Citrus Research Institute.

Genetic diversity of the trnL-trnF intergenic spacers and ITS region genes between 30 Citrus varieties.

Cutivar Sequence (bp)

C V PI
trnL-trnF intergeinc spacers 359/372 13 2
ITS1 214/250 34 8
5.8 S rDNA 155/163 8 none
ITS2 205/235 24 13
ITS (ITSI+5.8S rDNA+ITS2) 574/648 66 21

Sequence divergences in the Chloroplast trnL-trnF intergenic spacers (IGS) gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou
2 Tavares 0.008
3 Wilking 0.003 0.011
4 Haryejosaeng 0.005 0.014 0.003
52 Shiranuhi 0.003 0.011 0.000 0.003
6 Ovale_Kumquat 0.008 0.011 0.011 0.014 0.011
7 Marsh 0.000 0.008 0.003 0.005 0.003 0.008
8 Shinyegam 0.003 0.011 0.000 0.003 0.000 0.011 0.003
9 Trifoliate_orange 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005
10 Iwasaki_wase 0.005 0.014 0.003 0.005 0.003 0.014 0.005 0.003 0.008
11 Myagawa_wase 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003
12 Tamnanuenbong 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000
13 Cook_Eureka 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003
14 Cheongkyool 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003
15 Dangyooja 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003
16 Jinkyool 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003
17 Pyunkyool 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003
18 Dongjeongkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003
19 Kamja 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003
20 Jikak 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000
21 Yuzu 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000
22 Binkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003
23 Hongkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003 0.005
24 Byungkyool 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003
25 Nova 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003 0.000 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003
26 Washington_navel 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003
27 Hamlin 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003 0.005 0.003
28 Kiyomi 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003 0.000 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003 0.000 0.003 0.005
29 Inchangkyul 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003 0.000 0.003 0.003
30 Ichangensis 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003 0.000 0.003 0.003 0.000

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 372 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Sequence divergences in the ITS1 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.039
3 Wilking(MG702212) 0.008 0.040
4 Haryejosaeng(MG702222) 0.030 0.035 0.030
52 Shiranuhi(MG702207) 0.025 0.030 0.026 0.021
6 Ovale_Kumquat(MG702225) 0.035 0.040 0.036 0.022 0.026
7 Marsh(MG702214) 0.026 0.030 0.026 0.004 0.017 0.017
8 Shinyegam(MG702209) 0.008 0.039 0.008 0.021 0.025 0.035 0.017
9 Trifoliate_orange(MG702226) 0.030 0.035 0.030 0.026 0.021 0.031 0.021 0.030
10 Iwasaki_wase(MG702210) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021
11 Myagawa_wase(MG702201) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021 0.000
12 Tamnanuenbong(MG702220) 0.035 0.040 0.035 0.030 0.008 0.036 0.026 0.035 0.030 0.008 0.008
13 Cook_Eureka(MG702204) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030
14 Cheongkyool(MG702219) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004
15 Dangyooja(MG702202) 0.008 0.039 0.008 0.030 0.025 0.035 0.026 0.008 0.030 0.025 0.025 0.035 0.030 0.026
16 Jinkyool(MG702217) 0.030 0.035 0.031 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.031 0.008 0.004 0.030
17 Pyunkyool(MG702221) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008
18 Dongjeongkyool(MG702203) 0.004 0.035 0.004 0.026 0.021 0.031 0.021 0.004 0.026 0.021 0.021 0.030 0.026 0.021 0.004 0.026 0.026
19 Kamja(MG702199) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008 0.008 0.026
20 Jikak(MG702216) 0.013 0.035 0.013 0.026 0.021 0.031 0.021 0.013 0.026 0.021 0.021 0.030 0.026 0.021 0.013 0.026 0.026 0.008 0.026
21 Yuzu(MG702198) 0.030 0.035 0.030 0.008 0.013 0.022 0.004 0.021 0.026 0.013 0.013 0.021 0.008 0.004 0.030 0.008 0.008 0.026 0.008 0.026
22 Binkyool(MG702208) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004
23 Hongkyool(MG702224) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000
24 Byungkyool(MG702206) 0.021 0.026 0.021 0.008 0.013 0.013 0.004 0.021 0.017 0.013 0.013 0.021 0.008 0.004 0.021 0.008 0.008 0.017 0.008 0.017 0.008 0.004 0.004
25 Nova(MG702200) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000 0.000 0.004
26 Washington_navel(MG702211) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000 0.000 0.004 0.000
27 Hamlin(MG702223) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008 0.008 0.026 0.008 0.026 0.008 0.004 0.004 0.008 0.004 0.004
28 Kiyomi(MG702218) 0.030 0.026 0.030 0.026 0.004 0.031 0.021 0.030 0.026 0.004 0.004 0.013 0.026 0.021 0.030 0.026 0.026 0.025 0.026 0.025 0.017 0.021 0.021 0.017 0.021 0.021 0.026
29 Inchangkyul(MG702215) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021 0.000 0.000 0.008 0.021 0.017 0.025 0.021 0.021 0.021 0.021 0.021 0.013 0.017 0.017 0.013 0.017 0.017 0.021 0.004
30 Ichangensis(MG702213) 0.035 0.040 0.035 0.021 0.026 0.026 0.017 0.035 0.031 0.026 0.026 0.035 0.021 0.017 0.035 0.021 0.021 0.030 0.021 0.030 0.021 0.017 0.017 0.013 0.017 0.017 0.021 0.030 0.026

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total o f 2 43 p ositions i n t he f inal d ataset. E volutionary a nalyses w ere c onducted i n M EGA5.

Sequence divergences in the 5.8S rDNA gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Satianyou(MG702205)
2 Tavares(MG702227) 0.012
3 Wilking(MG702212) 0.006 0.006
4 Haryejosaeng(MG702222) 0.012 0.012 0.006
52 Shiranuhi(MG702207) 0.006 0.006 0.000 0.006
6 Ovale_Kumquat(MG702225) 0.006 0.006 0.000 0.006 0.000
7 Marsh(MG702214) 0.006 0.006 0.000 0.006 0.000 0.000
8 Shinyegam(MG702209) 0.006 0.006 0.000 0.006 0.000 0.000 0.000
9 Trifoliate_orange(MG702226) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000
10 Iwasaki_wase(MG702210) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000
11 Myagawa_wase(MG702201) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006
12 Tamnanuenbong(MG702220) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006
13 Cook_Eureka(MG702204) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006
14 Cheongkyool(MG702219) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006
15 Dangyooja(MG702202) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.013 0.006
16 Jinkyool(MG702217) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006
17 Pyunkyool(MG702221) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000
18 Dongjeongkyool(MG702203) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000
19 Kamja(MG702199) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000
20 Jikak(MG702216) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000
21 Yuzu(MG702198) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006
22 Binkyool(MG702208) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006
23 Hongkyool(MG702224) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000
24 Byungkyool(MG702206) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000
25 Nova(MG702200) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000
26 Washington_navel(MG702211) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000
27 Hamlin(MG702223) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000
28 Kiyomi(MG702218) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006
29 Inchangkyul(MG702215) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006
30 Ichangensis(MG702213) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 163 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Sequence divergences in the ITS2 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.009
3 Wilking(MG702212) 0.004 0.014
4 Haryejosaeng(MG702222) 0.023 0.023 0.027
52 Shiranuhi(MG702207) 0.023 0.023 0.027 0.037
6 Ovale_Kumquat(MG702225) 0.032 0.023 0.037 0.027 0.046
7 Marsh(MG702214) 0.018 0.018 0.023 0.004 0.032 0.023
8 Shinyegam(MG702209) 0.004 0.014 0.000 0.027 0.027 0.037 0.023
9 Trifoliate_orange(MG702226) 0.032 0.032 0.037 0.018 0.046 0.027 0.013 0.037
10 Iwasaki_wase(MG702210) 0.027 0.027 0.032 0.042 0.004 0.051 0.037 0.032 0.051
11 Myagawa_wase(MG702201) 0.023 0.023 0.027 0.037 0.000 0.046 0.032 0.027 0.046 0.004
12 Tamnanuenbong(MG702220) 0.023 0.023 0.027 0.037 0.000 0.046 0.032 0.027 0.046 0.004 0.000
13 Cook_Eureka(MG702204) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032
14 Cheongkyool(MG702219) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000
15 Dangyooja(MG702202) 0.023 0.023 0.027 0.037 0.009 0.046 0.032 0.027 0.046 0.013 0.009 0.009 0.032 0.032
16 Jinkyool(MG702217) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032
17 Pyunkyool(MG702221) 0.023 0.023 0.027 0.018 0.037 0.027 0.014 0.027 0.027 0.042 0.037 0.037 0.014 0.014 0.037 0.014
18 Dongjeongkyool(MG702203) 0.004 0.014 0.000 0.027 0.027 0.037 0.023 0.000 0.037 0.032 0.027 0.027 0.023 0.023 0.027 0.023 0.027
19 Kamja(MG702199) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023
20 Jikak(MG702216) 0.018 0.027 0.023 0.013 0.042 0.032 0.009 0.023 0.023 0.046 0.042 0.042 0.009 0.009 0.042 0.009 0.023 0.023 0.009
21 Yuzu(MG702198) 0.027 0.027 0.032 0.014 0.042 0.032 0.009 0.032 0.023 0.047 0.042 0.042 0.009 0.009 0.042 0.009 0.023 0.032 0.009 0.018
22 Binkyool(MG702208) 0.023 0.023 0.027 0.018 0.037 0.027 0.014 0.027 0.027 0.042 0.037 0.037 0.014 0.014 0.037 0.014 0.000 0.027 0.014 0.023 0.023
23 Hongkyool(MG702224) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014
24 Byungkyool(MG702206) 0.027 0.027 0.032 0.014 0.042 0.032 0.009 0.032 0.023 0.046 0.042 0.042 0.009 0.009 0.042 0.009 0.004 0.032 0.009 0.018 0.018 0.004 0.009
25 Nova(MG702200) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009
26 Washington_navel(MG702211) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009 0.000
27 Hamlin(MG702223) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009 0.000 0.000
28 Kiyomi(MG702218) 0.018 0.018 0.023 0.032 0.009 0.042 0.028 0.023 0.042 0.014 0.009 0.009 0.028 0.028 0.014 0.028 0.032 0.023 0.028 0.037 0.037 0.032 0.028 0.037 0.028 0.028 0.028
29 Inchangkyul(MG702215) 0.004 0.014 0.000 0.027 0.027 0.037 0.023 0.000 0.037 0.032 0.027 0.027 0.023 0.023 0.027 0.023 0.027 0.000 0.023 0.023 0.032 0.027 0.023 0.032 0.023 0.023 0.023 0.023
30 Ichangensis(MG702213) 0.023 0.023 0.027 0.009 0.037 0.027 0.004 0.027 0.018 0.042 0.037 0.037 0.004 0.004 0.037 0.004 0.018 0.027 0.004 0.013 0.014 0.018 0.004 0.014 0.004 0.004 0.004 0.032 0.027

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 224 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Sequence divergences in the total ITS gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.021
3 Wilking(MG702212) 0.006 0.021
4 Haryejosaeng(MG702222) 0.023 0.024 0.023
52 Shiranuhi(MG702207) 0.019 0.021 0.019 0.023
6 Ovale_Kumquat(MG702225) 0.026 0.024 0.026 0.019 0.026
7 Marsh(MG702214) 0.018 0.019 0.018 0.005 0.018 0.015
8 Shinyegam(MG702209) 0.006 0.021 0.003 0.019 0.019 0.026 0.015
9 Trifoliate_orange(MG702226) 0.024 0.026 0.024 0.018 0.024 0.021 0.013 0.024
10 Iwasaki_wase(MG702210) 0.021 0.023 0.021 0.024 0.002 0.028 0.019 0.021 0.026
11 Myagawa_wase(MG702201) 0.021 0.023 0.021 0.024 0.002 0.028 0.019 0.021 0.026 0.003
12 Tamnanuenbong(MG702220) 0.023 0.024 0.023 0.026 0.003 0.030 0.021 0.023 0.028 0.005 0.005
13 Cook_Eureka(MG702204) 0.021 0.023 0.021 0.008 0.021 0.018 0.003 0.018 0.016 0.023 0.023 0.024
14 Cheongkyool(MG702219) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003
15 Dangyooja(MG702202) 0.015 0.026 0.015 0.028 0.014 0.031 0.023 0.015 0.029 0.016 0.016 0.018 0.026 0.023
16 Jinkyool(MG702217) 0.019 0.021 0.019 0.006 0.020 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.025
17 Pyunkyool(MG702221) 0.021 0.023 0.021 0.011 0.021 0.018 0.006 0.018 0.019 0.023 0.023 0.024 0.010 0.006 0.026 0.008
18 Dongjeongkyool(MG702203) 0.005 0.019 0.002 0.021 0.018 0.024 0.016 0.002 0.023 0.019 0.019 0.021 0.019 0.016 0.013 0.018 0.019
19 Kamja(MG702199) 0.019 0.021 0.019 0.006 0.019 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.024 0.003 0.008 0.018
20 Jikak(MG702216) 0.013 0.024 0.013 0.016 0.023 0.023 0.011 0.013 0.018 0.024 0.024 0.026 0.014 0.011 0.021 0.013 0.018 0.011 0.013
21 Yuzu(MG702198) 0.024 0.026 0.024 0.011 0.021 0.021 0.006 0.021 0.019 0.023 0.023 0.025 0.010 0.006 0.030 0.008 0.013 0.023 0.008 0.018
22 Binkyool(MG702208) 0.019 0.021 0.019 0.010 0.019 0.016 0.005 0.016 0.018 0.021 0.021 0.023 0.008 0.005 0.024 0.006 0.002 0.018 0.006 0.016 0.011
23 Hongkyool(MG702224) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005
24 Byungkyool(MG702206) 0.019 0.021 0.019 0.010 0.020 0.016 0.005 0.019 0.014 0.021 0.021 0.023 0.008 0.005 0.025 0.006 0.005 0.018 0.006 0.013 0.011 0.003 0.005
25 Nova(MG702200) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005 0.000 0.005
26 Washington_navel(MG702211) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005 0.000 0.005 0.000
27 Hamlin(MG702223) 0.019 0.021 0.019 0.006 0.019 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.024 0.003 0.008 0.018 0.003 0.013 0.008 0.006 0.002 0.006 0.002 0.002
28 Kiyomi(MG702218) 0.021 0.019 0.021 0.024 0.006 0.028 0.019 0.021 0.026 0.008 0.008 0.010 0.023 0.019 0.019 0.021 0.023 0.019 0.021 0.024 0.023 0.021 0.019 0.021 0.019 0.019 0.021
29 Inchangkyul(MG702215) 0.013 0.018 0.010 0.019 0.010 0.023 0.015 0.010 0.021 0.011 0.011 0.013 0.018 0.015 0.021 0.016 0.018 0.008 0.016 0.016 0.018 0.016 0.015 0.016 0.015 0.015 0.016 0.011
30 Ichangensis(MG702213) 0.023 0.024 0.023 0.013 0.023 0.019 0.008 0.023 0.018 0.024 0.024 0.026 0.011 0.008 0.028 0.010 0.014 0.021 0.010 0.016 0.014 0.013 0.008 0.010 0.008 0.008 0.010 0.025 0.019

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 630 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 1 List of 30 Citrus cultivars used in this study and their numbers.

zNumber submitted to Genbank

Table 2 Primer sets used for the amplification of chloroplast trnL-trnF and nuclear ribosomal DNA ITS regions.

zTM value: https://sg.idtdna.com/calc/analyzer

Table 3 Sequence length and G+C content (%) of the trnL-trnF intergenic spacers and ITS region genes and comparison between Citrus inchangenesis ‘Ichangensis’ and ‘Inchangkyul’ cultivars.

zIt is Citrus ichangensis harvested in Citrus Research Institute.

y‘Inchangkyul’ cultivar using in this study was harvested in Citrus Research Institute.

Table 4 Genetic diversity of the trnL-trnF intergenic spacers and ITS region genes between 30 Citrus varieties.
Table 5 Sequence divergences in the Chloroplast trnL-trnF intergenic spacers (IGS) gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 372 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 6 Sequence divergences in the ITS1 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total o f 2 43 p ositions i n t he f inal d ataset. E volutionary a nalyses w ere c onducted i n M EGA5.

Table 7 Sequence divergences in the 5.8S rDNA gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 163 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 8 Sequence divergences in the ITS2 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 224 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 9 Sequence divergences in the total ITS gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 630 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.