Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

Development of japonica Rice Lines with Four Bacterial Blight Resistance Genes using Phenotypic and Marker-assisted Selection


Published online: May 31, 2016

1 농촌진흥청 국립식량과학원,

1 National Institute of Crop Science, RDA, Wanju 55365, Korea

2 농촌진흥청 연구정책국,

2 Research Policy Bureau, RDA, Jeonju 54875, Korea

3 충남대학교 농업생명과학대학

3 Department of Agronomy, Chungnam National University, Daejoen 34134, Korea

*Corresponding author (mayoe@korea.kr, +82- 63-238-5216, +82-63-238-5205)
• Received: March 1, 2016   • Accepted: April 18, 2016

© The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 324 Views
  • 2 Download
  • 9 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • ‘Drimi9ho’, A Lodging Tolerance with Mid-late Maturing, Improved White-backed Planthopper (Sogatella furcifera) and Cultivation Stability
    Jae-Ryoung Park, Eun-Gyeong Kim, Yoon-Hee Jang, Kyung-Min Kim
    Korean Journal of Breeding Science.2025; 57(4): 493.     CrossRef
  • Mid-Late Maturing Glutinous Rice Cultivar ‘JJ644wx’ with Multiple Disease Resistance and Lodging Tolerance
    Hyun-Su Park, Chang-Min Lee, O-Young Jeong, Jung-Pil Suh, Jeonghwan Seo, Songhee Park, Keon-Mi Lee, Jae-Ryoung Park, Su-Kyung Ha, Hyun-Sook Lee, Ki-Young Kim
    Korean Journal of Breeding Science.2024; 56(3): 319.     CrossRef
  • The Multiple Disease-resistant, Mid-late Maturing Rice Cultivar ‘Chamdongjin’, Carrying the Bacterial Blight Resistance Gene Xa21, with the Genetic Background of ‘Sindongjin’
    Hyun-Su Park, Man-Kee Baek, Woo-Jae Kim, Jung-Pil Suh, Jeom-Ho Lee, Ji-Ung Jeung, Choon-Song Kim, O-Young Jeong, Deok-Ryeol Lee, Chang-Min Lee, Jong-Min Jeong, Young-Jun Mo, Su-Kyung Ha, Dong-Kyu Lee, Hyeonso Ji, Jeonghwan Seo, Jae-Ryoung Park, Hyun-Sook
    Korean Journal of Breeding Science.2023; 55(1): 86.     CrossRef
  • Breeding a Giant Embryo and Multi-disease-resistant Rice Cultivar, ‘Drimi4ho’
    Eun-Gyeong Kim, Jae-Ryoung Park, Yoon-Hee Jang, Jae-Keun Sohn, Gang-Seob Lee, Kyung-Min Kim
    Korean Journal of Breeding Science.2023; 55(1): 36.     CrossRef
  • Mid-Late Maturing High-Yielding Black Rice Cultivar “JJ603Black” with Multiple-Disease Resistance
    Hyun-Su Park, Chang-Min Lee, Jeonghwan Seo, Jae-Ryoung Park, Man-Kee Baek, O-Yeong Jeong
    Korean Journal of Breeding Science.2022; 54(4): 395.     CrossRef
  • Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross
    Chang-Min Lee, Hyun-Su Park, Man-Kee Baek, Jung-Pil Suh, O-Young Jeong, Song-Joong Yun, Suk-Man Kim
    Korean Journal of Breeding Science.2021; 53(4): 392.     CrossRef
  • Multiple Disease Resistant Early Maturing Rice Cultivar ‘IS592BB’ with the Genetic Background of ‘Unkwang’
    Hyun-Su Park, Man-Kee Baek, Woo-Jae Kim, Chang-Min Lee, Hyeonso Ji, Jung-Pil Suh, O-Young Jeong, Young-Chan Cho, Jeom-Ho Lee
    Korean Journal of Breeding Science.2020; 52(4): 473.     CrossRef
  • High Grain Quality Mid-late Maturing Rice Cultivar ‘Yechan’ with Lodging Tolerance and Multiple Disease Resistance
    Man-Kee Baek, Hyun-Su Park, Jeong-Kwon Nam, Young-Chan Cho, Ki-Young Kim, Jeong-Ju Kim, Woo-Jae Kim, Woon-Chul Shin, Ji-Ung Jeung, Choon-Song Kim, Jong-Min Jeong, Keon-Mi Lee, Seul-Gi Park, Chang-Min Lee, Jung-Pil Suh, Jeom-Ho Lee
    Korean Journal of Breeding Science.2019; 51(4): 504.     CrossRef
  • Bacterial Blight-Resistant Medium Maturing Rice Cultivar ‘Haepum’ with High Grain Quality
    Jeong-Kwon Nam, Hyun-Su Park, Man-Kee Baek, Young-Chan Cho, Woo-Jae Kim, Jeong-Ju Kim, Bo-Kyeong Kim, Ki-Young Kim, Woon-Chul Shin, Jong-Cheol Ko, Gun-Mi Lee, Seul-Gi Park, Chang-Min Lee, Choon-Song Kim, Jung-Pil Suh, Jeom-Ho Lee
    Korean Journal of Breeding Science.2019; 51(3): 222.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Development of japonica Rice Lines with Four Bacterial Blight Resistance Genes using Phenotypic and Marker-assisted Selection
Korean. J. Breed. Sci.. ;48(2):140-158.   Published online June 30, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Development of japonica Rice Lines with Four Bacterial Blight Resistance Genes using Phenotypic and Marker-assisted Selection
Korean. J. Breed. Sci.. ;48(2):140-158.   Published online June 30, 2016
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
Development of japonica Rice Lines with Four Bacterial Blight Resistance Genes using Phenotypic and Marker-assisted Selection
Image Image Image Image Image Image Image
Fig. 1. Schematic diagram for pyramiding four R genes of bacterial blight based on marker-assisted selection (MAS) and phenotypic selection (PS).
Fig. 2. Resistance reaction (A) against K1 and K3a races and genotyping using gene-specific DNA markers (B) of IR24 donor for IRBB lines, IRBB lines carrying Xa1, Xa3, xa5, and Xa21, parents consisted of Ilmi having Xa1 and HR27814-B-47-1-1 having Xa3+xa5+Xa21, F1 plants, and F2 plants for anther culture. PCR analysis of lines to confirm resistance genes using the gene specific DNA markers. Xa1, Xa3, xa5, and Xa21 were confirmed by PCR product amplified with primer, 16PFXa1(cleaved by EcoRV), BB3-R and BB3-S, 10603.T10Dw (cleaved by Rsa I), and U1/I1, respectively. White bar indicates 10cm.
Fig. 3. Resistance reaction of IR24 (A), IRBB1 (B), IRBB3 (C), IRBB5 (D), IRBB21 (E), Ilmi (F), Iksan575 (G), HR30348(F2)-AC1 (H), and HR30348(F2)-AC4 (I) against 16 bacterial blight isolates. 1: HB1009, 2: HB1013, 3: HB1014, 4: HB2010, 5: HB2024, 6: HB2038, 7: HB3011, 8: HB3055, 9: HB3079, 10: HB4024, 11: HB4027, 12: HB4040, 13: HB4044, 14: HB4079, 15: HB6142, 16: HB6159.
Fig. 5. Resistance reaction of lines against K3a race (A) and PCR analysis to confirm resistance genes using the gene specific DNA markers (B). Xa1, Xa3, xa5, and Xa21 were confirmed by PCR product amplified with primers, puXa1L (cleaved by EcoRV, a), puXa3U1 (Pst I, b), puXa5U (Sml I, c), and U1/I1 (d), respectively. The white bar indicates 10 cm. M: DNA size marker, 1: Nampyeong, 2: Jinbaek, 3: Ilmi, 4: Saeilmi, 5: Iksan575 (HR27814-B-47-1-1), 6-12: RDL1-7, 13-22: RPL1-10.
Fig. 4. Radial graph of resistance reaction of monogenic lines, parents for genes pyramiding, and doubled haploid lines carrying four resistance genes against each of 16 Korean Xanthomonas oryzae pv. oryzae isolates.
Fig. 6. Number and rate of japonica rice varieties with resistant to bacterial blight developed at National Institute of Crop Science during the indicated period.
Fig. 7. Genealogical relationship of resistant varieties to K3a race. Grey, blue, yellow, and red boxes indicate the susceptible varieties to K1, K2, K3, and K3a races, resistant varieties to K1 race, resistant varieties to K1, K2, and K3 races, and resistant varieties to K1, K2, K3, and K3a races, respectively.
Development of japonica Rice Lines with Four Bacterial Blight Resistance Genes using Phenotypic and Marker-assisted Selection

Gene-specific PCR primers and functional marker primers used for the identification of bacterial blight resistance genes.

R-genes Chr.No. Marker name Primer sequences
Expected size (bp) Reference
Forward(5’-3’), Reverse(5’-3’)

Xa1 4 16PFXa1 ACGGTTCTGAAGGTCGTCATTGCAAGAGCTCCGGTTTAAG 201,155 Shin et al.2006
Xa1 4 puXa1L ATTTGGGGAGTTCGTCAGAGCCATTGGAGCGGATTGGTTTTG 473,350 Jeung et al.(unpublished)
Xa3 11 BB-R CCACAATGCCATGTCAGGTGGCATCCCTGCAAGGTGTTGGAGGATTGGCAT 255 Hur et al.2013
xa3 11 BB-S CGGAGCGACACAGCTATCATCGTGAGGTTCCCTATGGCGATT 743 Hur et al.2013
Xa3 11 puXa3U1 CAGTATGGATTTTCGTTGCGCCGTATAGCTGGTTAAACTGTAG 383 Jeung et al.(unpublished)
xa5 5 10603.T.10Dw GCACTGCAACCATCAATGAATCCCTAGGAGAAACTAGCCGTCCA 280 Park et al.2013
xa5 5 puXa5U CAAGAAGAGCAGAGCAGAGCTCCTTTAGCAAGGTGTGTACG 496,300 Jeung et al.(unpublished)
Xa21 11 U1/I1 CGATCGGTATAACAGCAAAACATAGCAACTGATTGCTTGG 1,400 Wang et al.1996

Segregation ratio of resistance genes in F2 population using gene-specific DNA markers.

R-gene No. of F2 plants
Expected ratio x2 P-value
AAz AB BB Total

Xa1 40 107 52 199 1:2:1 2.578 0.276
Xa3 41 102 56 199 1:2:1 2.387 0.303
xa5 56 101 42 199 1:2:1 2.015 0.365
Xa21 160 39 199 3:1 3.097 0.078

AA: homozygote for resistance gene, AB: heterozygote, BB: homozygote for susceptible gene, AA/AB: homo for resistance or heterozygote for Xa21

Average lesion length of F2 plants in resistance gene combinations after inoculation with K1 and K3a races.

Gene combination Genotype
No. of F2 plants Lesion length (cm)
Xa1 Xa3 xa5 Xa21 K1 K3a

AAz AA AA AA/AB 4 0.1 0.3
Xa1+Xa3+xa5+Xa21 AA AB AA AA/AB 2 0.1 0.6
AB AA AA AA/AB 1 0.1 0.4
AB AB AA AA/AB 13 0.1 0.6
Xa1+Xa3+xa5 AB AB AA BB 4 0.1 2.7
AA AA AB AA/AB 2 0.2 2.6
AA AA BB AA/AB 2 0.1 1.1
AA AB AB AA/AB 7 0.2 1.9
Xa1+Xa3+Xa21 AA AB BB AA/AB 6 0.1 1.5
AB AA AB AA/AB 11 0.1 1.9
AB AA BB AA/AB 5 0.1 1.9
AB AB AB AA/AB 25 0.2 2.1
AB AB BB AA/AB 9 0.2 2.2
Xa1+xa5+Xa21 AA BB AA AA/AB 4 0.1 0.6
AB BB AA AA/AB 5 0.1 0.7
Xa3+xa5+Xa21 BB AA AA AA/AB 6 1.2 0.6
BB AB AA AA/AB 7 1.8 0.7
AA AA AB BB 1 0.2 8.7
AA AB AB BB 5 0.2 12.1
Xa1+Xa3 AA AB BB BB 1 0.2 11.8
AB AA BB BB 1 0.2 14.6
AB AB AB BB 5 0.2 13.7
AB AB BB BB 4 0.2 12.7
Xa1+xa5 AB BB AA BB 2 0.1 2.6
AA BB AB AA/AB 3 0.1 1.3
Xa1+Xa21 AA BB BB AA/AB 1 0.2 2.5
AB BB AB AA/AB 13 0.2 1.8
AB BB BB AA/AB 2 0.2 2.3
Xa3+xa5 BB AB AA BB 2 1.5 2.9
BB AA AB AA/AB 6 4.6 2.2
Xa3+Xa21 BB AA BB AA/AB 2 3.5 2.2
BB AB AB AA/AB 7 3.4 2.3
BB AB BB AA/AB 3 3.7 2.2
xa5+Xa21 BB BB AA AA/AB 4 1.4 1.3
AA BB AB BB 1 0.1 13.2
Xa1 AA BB BB BB 1 0.3 11.2
AB BB AB BB 5 0.3 13.0
AB BB BB BB 2 0.2 14.3
Xa3 BB AB AB BB 2 4.1 11.3
xa5 BB BB AA BB 2 2.6 2.2
Xa21 BB BB BB AA/AB 3 15.9 1.9
BB BB AB AA/AB 7 12.5 2.0
no gene BB BB AB BB 1 20.5 18.5
Total 199

AA: homozygote for resistance gene, AB: heterozygote, BB: homozygote for susceptible gene, AA/AB: homo for resistance or heterozygote for Xa21

Anther culture ability and doubled haploid lines derived from the cross of Ilmi/HR27814-B-47-1-1.

Cross (gen.) Anther cultured (no.) Cali induced (no. and %) Plant regeneration (no. and %)z Green plants (no. and %)y Albino (no. and %)x Doubled haploid lines (no.)w

Ilmi/HR27814-B-47-1-1 (F2) 7,700 180(2.3) 21(11.7) 16(76.2) 5(23.8) 8

Percent plant regeneration is the number of plants regenerated over number of cali plated

Percent green is the number of green plants regenerated over total plants regenerated

Percent albino is the number of albino plants regenerated over total plants regenerated

Doubled haploid lines are harvested plants having fertile grain

Resistance reaction of monogenic lines, parents for genes pyramiding, and doubled haploid lines carrying four resistance genes against each of 16 Korean Xanthomonas oryzae pv. oryzae isolates.

Isolate IR24
IRBB1
IRBB3
IRBB5
IRBB21
Ilmi
Iksan575
DH lines average
HB30348 (F2)-AC1
HB30348 (F2)-AC2
HB30348( F2)-AC3
HB30348 (F2)-AC4
HB30348 (F2)-AC5
HB30348 (F2)-AC6
HB30348(F2)-AC7
Xa18 Xa1 Xa3 xa5 Xa21 Xa1 Xa3+xa5+Xa21 Xa1+Xa3+xa5+Xa21 Xa1+Xa3+xa5+Xa21 Xa1+Xa3+xa5+Xa21 Xa1+Xa3+xa5+Xa21 Xa1+Xa3+xa5+Xa21 Xa1+Xa3+xa5+Xa21 Xa1+Xa3+xa5+Xa21 Xa1+Xa3+xa5+Xa21

HB1009 16.0(S) 16.3(S) 17.7(S) 1.5(R) 2.2(R) 13.0(S) 0.9(HR) 0.4(HR) 0.2(HR) 0.4(HR) 0.6(HR) 0.4(HR)(HR) 0.4(HR) 0.6(HR) 0.5(HR)
HB1014 15.3(S) 14.0(S) 7.3(MR) 1.2(R) 1.8(R) 20.0(S) 0.4(HR) 0.2(HR) 0.1(HR) 0.2(HR) 0.4(HR) 0.2(HR) 0.2(HR) 0.2(HR) 0.2(HR)
HB1015 16.7(S) 13.7(S) 9.7(MR) 1.2(R) 1.2(R) 16.3(S) 0.3(HR) 0.2(HR) 0.1(HR) 0.1(HR) 0.3(HR) 0.1(HR) 0.2(HR) 0.2(HR) 0.2(HR)
HB2010 16.0(S) 0.2(HR) 7.0(MR) 1.1(R) 10.7(S) 0.2(HR) 0.8(HR) 0.1(HR) 0.2(HR) 0.1(HR) 0.2(HR) 0.1(HR) 0.1(HR) 0.1(HR) 0.1(HR)
HB2024 16.3(S) 17.0(S) 15.7(S) 1.2(R) 1.5(R) 17.7(S) 0.3(HR) 0.3(HR) 0.3(HR) 0.4(HR) 0.2(HR) 0.4(HR) 0.3(HR) 0.5(HR) 0.4(HR)
HB2038 16.0(S) 14.7(S) 15.7(MR) 0.8(HR) 0.2(HR) 15.3(S) 0.3(HR) 0.2(HR) 0.1(HR) 0.2(HR) 0.1(HR) 0.1(HR) 0.1(HR) 0.1(HR) 0.4(HR)
HB3011 15.0(S) 0.3(HR) 8.3(S) 1.5(R) 17.3(S) 0.2(HR) 1.2(R) 0.2(HR) 0.2(HR) 0.2(HR) 0.2(HR) 0.2(HR) 0.2(HR) 0.1(HR) 0.1(HR)
HB3055 19.3(S) 17.7(S) 18.7(S) 1.8(R) 4.2(R) 22.7(S) 0.8(HR) 0.6(HR) 0.4(HR) 0.6(HR) 0.6(HR) 0.6(HR) 0.5(HR) 0.7(HR) 0.7(HR)
HB3079 15.0(S) 18.3(S) 18.3(S) 0.6(HR) 2.0(R) 19.0(S) 0.4(HR) 0.3(HR) 0.2(HR) 0.4(HR) 0.3(HR) 0.4(HR) 0.3(HR) 0.4(HR) 0.4(HR)
HB4024 14.3(S) 15.0(S) 16.3(S) 2.3(R) 2.5(R) 14.0(S) 0.8(HR) 0.5(HR) 0.3(HR) 0.3(HR) 0.5(HR) 0.5(HR) 0.4(HR) 0.5(HR) 0.9(HR)
HB4027 15.3(S) 0.3(HR) 9.7(MR) 1.3(R) 10.2(S) 0.3(HR) 1.1(R) 0.3(HR) 0.5(HR) 0.2(HR) 0.2(HR) 0.4(HR) 0.2(HR) 0.2(HR) 0.2(HR)
HB4040 17.7(S) 19.0(S) 19.0(S) 4.2(R) 5.3(R) 20.7(S) 0.8(HR) 0.6(HR) 0.4(HR) 0.6(HR) 0.6(HR) 0.8(HR) 0.5(HR) 0.9(HR) 0.6(HR)
HB4044 18.0(S) 17.7(S) 18.0(S) 3.2(R) 3.7(R) 19.7(S) 0.8(HR) 0.6(HR) 0.4(HR) 0.5(HR) 0.6(HR) 0.7(HR) 0.5(HR) 0.8(HR) 0.7(HR)
HB4079 18.0(S) 16.3(S) 15.3(S) 2.7(R) 2.3(R) 19.0(S) 0.7(HR) 0.6(HR) 0.4(HR) 0.4(HR) 0.7(HR) 0.7(HR) 0.4(HR) 0.8(HR) 0.6(HR)
HB6142 18.7(S) 17.7(S) 17.7(S) 2.2(R) 3.0(R) 20.0(S) 1.1(R) 0.7(HR) 0.5(HR) 0.7(HR) 0.7(HR) 0.7(HR) 0.7(HR) 0.9(HR) 0.8(HR)
HB6159 17.7(S) 19.0(S) 15.7(S) 1.5(R) 3.3(R) 19.0(S) 2.0(R) 0.6(HR) 0.4(HR) 0.6(HR) 0.6(HR) 0.7(HR) 0.6(HR) 0.9(HR) 0.6(HR)
Mean ± SD 16.6±1.47 13.5±6.85 14.4±4.36 1.8±0.94 4.5±4.52 14.8±7.68 0.8±0.43 0.4±0.20 0.3±0.13 0.4±0.18 0.4±0.21 0.4±0.24 0.4±0.19 0.5±0.0.11 0.5±0.0.25
C.V. (%) 8.9 50.6 30.3 53.9 101.3 51.9 54.8 50.4 44.3 48.2 51.4 55.1 53.4 67.0 54.6

Average lesion length was measured using 3 leaves severely infected

HR: Highly resistant (< 1 cm lesion length) R: Resistant (1-5 cm), MR: Moderately resistant (5-10 cm), S: Susceptible (> 10 cm)

History of selection of four breeding families in the F3 and F4 generations.

Breeding family F3

F4

Marker-assisted selection
Marker-assisted selection
Phenotypic selection to
K3a inoculation
Agronomic traits
Yield and quality
No. of plants Selected plants No. of lines Selected lines No. of lines Selected lines No. of lines Selected lines No. of lines Selected lines

HR30348-24 20 15 15 15 15 3 3 2 2 1
HR30348-164 20 18 18 18 18 6 6 2 2 0
HR30348-172 20 20 20 20 20 20 20 11 11 8
HR30348-178 20 20 20 20 20 20 20 5 5 1
Total 80 73 73 73 73 49 49 20 20 10

Pedigree and resistance genes of varieties and breeding lines and their resistance reaction to bacterial blight.

Var./line Cross Gen. R-genes Bacterial blight
K1 K2 K3 K3a

Nampyeong Iri390/Milyang95 - unknown Sz S S S
Jinbaek HR15204-38-3//Milyang165/Iksan438 - Xa3+xa5 HR HR HR R
Ilmi Milyang96//Milyang95/Seomjin - Xa1 HR S S S
Saeilmi Ilmi*5/Hwayeong - Xa1+Xa3 HR HR HR S
Iksan575 Iksan493//Hopum/HR24670-9-2-1 - Xa3+xa5+Xa21 HR HR HR HR
RDL1 (HB30348(F2)-AC1-1)y Ilmi/HR27814-B-47-1-1 AC2 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RDL2 (HB30348(F2)-AC2-1) Ilmi/HR27814-B-47-1-1 AC2 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RDL3 (HB30348(F2)-AC3-1) Ilmi/HR27814-B-47-1-1 AC2 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RDL4 (HB30348(F2)-AC4-1) Ilmi/HR27814-B-47-1-1 AC2 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RDL5 (HB30348(F2)-AC5-1) Ilmi/HR27814-B-47-1-1 AC2 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RDL6 (HB30348(F2)-AC6-1) Ilmi/HR27814-B-47-1-1 AC2 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RDL7 (HB30348(F2)-AC7-1) Ilmi/HR27814-B-47-1-1 AC2 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL1 (HB30348-24-17-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL2 (HB30348-172-1-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL3 (HB30348-172-2-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL4 (HB30348-172-4-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL5 (HB30348-172-6-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL6 (HB30348-172-7-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL7 (HB30348-172-9-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL8 (HB30348-172-10-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL9 (HB30348-172-11-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR
RPL10 (HB30348-178-10-3-1) Ilmi/HR27814-B-47-1-1 F6 Xa1+Xa3+xa5+Xa21 HR HR HR HR

HR, R, and S mean highly resistant, resistant, and susceptible to bacterial blight, respectively

RDL and RPL mean resistant lines by doubled haploid and pedigree method, respectively

Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice.

Var./line Control
K3a inoculation
Rough rice yield (g) Brown rice yield (g) Ratio of ripened grain (%) Perfect kernel of brown rice (%) Rough rice yield (g) Brown rice yield (g) Ratio of ripened grain (%) Perfect kernel of brown rice (%)

Nampyeong 621 475 94.3 88.4 542**z 406** 85.5** 80.5**
Jinbaek 562 434 96.3 93.0 550 ns 424 ns 96.1 ns 93.2ns
Ilmi 630 489 97 88.5 530** 412** 84.5** 81.2**
Saeilmi 602 473 96.8 89.2 500** 386** 83.2** 81.4**
Iksan575 599 468 95.6 91.2 590ns 460ns 94.4ns 90.5ns
RDL1 639 501 94.5 86.6 633ns 500ns 94ns 85.3ns
RDL2 606 473 95.1 87.6 600ns 469ns 95ns 86.2ns
RDL3 614 482 95.6 84.7 610ns 478ns 94.9ns 82.8ns
RDL4 631 494 95.4 88.9 625ns 485ns 94.4ns 86.5ns
RDL5 614 482 95.9 87.0 602ns 471ns 95.8ns 86.4ns
RDL6 602 470 95.8 87.4 602ns 468ns 93.4ns 85.3ns
RDL7 620 484 96.5 89.1 619ns 483ns 94.4ns 88.2ns
RPL1 590 468 96.9 82.2 576ns 452ns 97.0ns 81.4ns
RPL2 685 537 96.6 88.1 680ns 529ns 95.5ns 87.9ns
RPL3 612 473 95.4 86.3 610ns 470ns 95.6ns 86.6ns
RPL4 689 543 97.5 88.4 688ns 542ns 96.9ns 88.2ns
RPL5 627 490 95.5 89.3 615ns 478ns 95.2ns 89.0ns
RPL6 612 476 96.0 87.9 605ns 470ns 95.9ns 88.1ns
RPL7 638 495 95.9 89.0 632ns 492ns 95.8ns 88.9ns
RPL8 632 498 96.0 89.2 625ns 497ns 96.1ns 88.8ns
RPL9 654 513 97.5 88.4 625ns 508ns 96.8ns 86.8ns
RPL10 590 453 96.1 90.4 583ns 448ns 95.0ns 89.7ns

ns

mean no significant, significant at p < 0.01 by t-test, respectively

Yield-related traits of rice varieties and breeding lines at yield trial.

Var./line Heading date (DAS)z Culm length (cm) Panicle length (cm) No. of panicles per hill No. of spikelets per panicle Ratio of ripened grain (%) 1,000 grains weight of brwon rice (g) Rough rice yield (kg/10a) Brown/rough rice ratio (%) Brown rice yield (kg/10a) Index of brown rice yield (%)y

Nampyeong 103dCx 71defA 20ghB 14aA 96dB 93.9eB 21.2eC 704cAB 79.8eC 562cAB 100
Jinbaek 113aA 63hC 20hB 13abA 99dB 96.2bA 21.1efC 637eC 80.7cdB 514eC 91
Ilmi 102deC 70efA 21gB 13bAB 98dB 96.5bA 22.8bA 695cAB 81.3abcA 565cAB 101
Saeilmi 102deC 68fgAB 21gB 13bAB 95dB 96.7bA 22.4bcA 673cdB 81.2abcA 547cdB 97
Iksan575 110bB 65hBC 21ghB 13abA 95dB 95.0cdAB 22.2cAB 663cdeBC 81.2abcA 539cdeBC 96
RDL1 103d 72deg 23def 13b 105cd 94.3de 21.8cd 714bc 81.2abc 581bc 103
RDL2 103d 69fg 22f 13b 99d 95.1cd 21.0f 698c 81.2abc 567c 101
RDL3 103d 71def 23cdef 12c 106cd 95.2cd 21.3e 682cd 81.0abcd 552cd 98
RDL4 103d 73bcde 23cde 13b 106cd 95.4c 21.3e 697c 81.2abc 566c 101
RDL5 103d 72def 23ef 13ab 102d 95.8bc 21.7d 701c 81.4abc 571c 102
RDL6 103d 72def 24cde 13b 107bcd 94.6d 21.4de 699c 81.0abcd 566c 101
RDL7 103d 72cde 23cdef 13ab 96d 95.4c 21.6d 677cd 81.0abcd 548cd 98
Mean of RDL 103C 71A 23AB 13A 103B 95.1AB 21.4BC 695AB 81.2A 564AB 100
C.V.(%) 0.2 2.2 3.1 4.6 5.5 1.4 1.5 4.5 0.5 4.8
RPL1 95e 66gh 23cdef 12c 100d 97.0a 23.5a 661cde 81.6a 539cde 96
RPL2 102de 72def 23cde 13bc 124a 96.0b 22.0cd 744ab 81.0abcd 603ab 107
RPL3 102de 74bcd 24bc 11d 127a 95.6bc 22.1c 680cd 80.5d 548cd 97
RPL4 103d 77a 25a 12c 121ab 97.2a 22.7b 764a 81.3abc 621a 110
RPL5 102de 73bcde 24cd 12c 122a 94.6d 22.8b 714bc 81.0abcd 579bc 103
RPL6 102de 73bcde 23cde 12c 107bcd 95.7bc 22.1c 706c 80.8bcd 571c 102
RPL7 102de 73bcd 24cd 12cd 128a 95.4c 21.2e 729b 81.5ab 594ab 106
RPL8 102de 76ab 25ab 11d 121ab 96.6b 22.2c 719b 81.2abc 584b 104
RPL9 103d 76abc 24cde 12cd 120abc 97.1a 21.4de 745ab 81.4abc 606ab 108
RPL10 106c 65h 21g 13bc 101d 96.1b 22.7b 668cd 81.1abcd 542cd 96
Mean of RPL 102C 72A 24A 12B 117A 96.1A 22.3AB 713A 81.1A 579A 103
C.V.(%) 2.9 5.8 5.1 6.7 10.9 1.1 3.3 6.3 0.5 6.1

Days after seeding

Brown rice yield of Nampyeong as a standard

Means with the same letters in a column are not significantly different at p < 0.05 (ANOVA followed by DMRT). Small and capital letters indicate statistic difference between lines and breeding methods, respectively.

Quality-related traits of milled rice of varieties and breeding lines at yield trial.

Var./line Head rice (%) Opaque rice (%) Damaged rice (%) Broken rice (%) Colored rice (%) Protein content (%) Amylose content (%) Glossiness (TOYO value)

Nampyeong 97.0aA 0.4dAB 0.5cBC 2.0fBC 0.1cA 5.9bA 18.5hE 89.5abAB
Jinbaek 96.9aA 0.5cdAB 0.9bA 1.5gC 0.1cA 5.4dD 20.7aA 91.4aA
Ilmi 95.7bAB 0.4dAB 0.3dC 3.5cA 0.1cA 5.7bcB 18.9gD 87.2bcAB
Saeilmi 96.3abAB 0.4dAB 0.3dC 2.9dAB 0.1cA 5.7bcB 19.0fgD 85.9cB
Iksan575 94.6cdB 0.2dB 0.6cB 4.3bA 0.2bA 5.7bcBC 20.2cB 87.3bcAB
RDL1 93.6e 0.8cd 1.2a 4.4b 0.1c 5.5cd 20.2bc 79.9de
RDL2 95.4b 0.4d 1.1a 3.0d 0.1c 5.5cd 20.5ab 88.9ab
RDL3 93.3e 0.5cd 1.0ab 5.1a 0.2b 5.5cd 20.2bc 83.6cd
RDL4 94.8c 0.5cd 1.0ab 3.6c 0.1c 5.5cd 20.2bc 86.8bc
RDL5 94.8c 0.5cd 1.0ab 3.7c 0.1c 5.6c 20.4abc 86.7bc
RDL6 95.5b 0.4d 0.8b 3.2cd 0.1bc 5.5cd 20.1c 87.0bc
RDL7 95.5b 0.3d 1.0ab 3.2cd 0.1c 5.6c 20.3bc 82.0d
Mean of RDL 94.7B 0.5AB 1.0A 3.7A 0.1A 5.5CD 20.3B 85.0B
C.V. (%) 1.2 40.0 30.0 24.3 100.0 2.0 1.0 4.8
RPL1 94.6cd 0.5cd 0.4cd 4.4b 0.2ab 6.2a 18.7gh 77.7e
RPL2 95.5b 1.6b 0.5c 2.5e 0.0d 5.7bc 19.3ef 84.0cd
RPL3 94.6cd 1.6b 0.6c 3.2cd 0.1c 5.7bc 19.0fg 78.0e
RPL4 92.9f 2.9a 0.4cd 3.6c 0.1c 5.7bc 19.5de 84.4cd
RPL5 95.3b 0.8cd 0.7bc 3.0d 0.2b 5.7bc 19.5de 83.2cd
RPL6 95.8b 1.1bc 0.6c 2.5e 0.1c 5.9b 19.4de 76.2f
RPL7 96.4ab 0.7cd 0.6c 2.2f 0.1cd 5.8b 19.3de 78.6e
RPL8 95.2b 1.7b 0.5c 2.6e 0.1c 5.8b 19.3de 79.7de
RPL9 94.7c 0.7cd 0.7bc 3.7c 0.2b 5.8b 19.6d 79.3de
RPL10 94.1d 0.2d 0.5c 4.9ab 0.3a 5.8b 20.1c 88.0abc
Mean of RPL 94.9B 1.2A 0.5CB 3.3AB 0.1A 5.8AB 19.4C 80.9C
C.V. (%) 1.6 75.0 40.0 39.4 100.0 3.8 2.2 6.9

Means with the same letters in a column are not significantly different at p < 0.05 (ANOVA followed by DMRT). Small and capital letters indicate statistic difference between lines and breeding methods, respectively.

Table 1. Gene-specific PCR primers and functional marker primers used for the identification of bacterial blight resistance genes.
Table 2. Segregation ratio of resistance genes in F2 population using gene-specific DNA markers.

AA: homozygote for resistance gene, AB: heterozygote, BB: homozygote for susceptible gene, AA/AB: homo for resistance or heterozygote for Xa21

Table 3. Average lesion length of F2 plants in resistance gene combinations after inoculation with K1 and K3a races.

AA: homozygote for resistance gene, AB: heterozygote, BB: homozygote for susceptible gene, AA/AB: homo for resistance or heterozygote for Xa21

Table 4. Anther culture ability and doubled haploid lines derived from the cross of Ilmi/HR27814-B-47-1-1.

Percent plant regeneration is the number of plants regenerated over number of cali plated

Percent green is the number of green plants regenerated over total plants regenerated

Percent albino is the number of albino plants regenerated over total plants regenerated

Doubled haploid lines are harvested plants having fertile grain

Table 5. Resistance reaction of monogenic lines, parents for genes pyramiding, and doubled haploid lines carrying four resistance genes against each of 16 Korean Xanthomonas oryzae pv. oryzae isolates.

Average lesion length was measured using 3 leaves severely infected

HR: Highly resistant (< 1 cm lesion length) R: Resistant (1-5 cm), MR: Moderately resistant (5-10 cm), S: Susceptible (> 10 cm)

Table 6. History of selection of four breeding families in the F3 and F4 generations.
Table 7. Pedigree and resistance genes of varieties and breeding lines and their resistance reaction to bacterial blight.

HR, R, and S mean highly resistant, resistant, and susceptible to bacterial blight, respectively

RDL and RPL mean resistant lines by doubled haploid and pedigree method, respectively

Table 8. Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice.

ns

mean no significant, significant at p < 0.01 by t-test, respectively

Table 9. Yield-related traits of rice varieties and breeding lines at yield trial.

Days after seeding

Brown rice yield of Nampyeong as a standard

Means with the same letters in a column are not significantly different at p < 0.05 (ANOVA followed by DMRT). Small and capital letters indicate statistic difference between lines and breeding methods, respectively.

Table 10. Quality-related traits of milled rice of varieties and breeding lines at yield trial.

Means with the same letters in a column are not significantly different at p < 0.05 (ANOVA followed by DMRT). Small and capital letters indicate statistic difference between lines and breeding methods, respectively.